Incidental Mutation 'R6400:Dytn'
ID516115
Institutional Source Beutler Lab
Gene Symbol Dytn
Ensembl Gene ENSMUSG00000069085
Gene Namedystrotelin
SynonymsLOC241073
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6400 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location63622851-63686927 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 63641176 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 408 (L408*)
Ref Sequence ENSEMBL: ENSMUSP00000087787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090313]
Predicted Effect probably null
Transcript: ENSMUST00000090313
AA Change: L408*
SMART Domains Protein: ENSMUSP00000087787
Gene: ENSMUSG00000069085
AA Change: L408*

DomainStartEndE-ValueType
Pfam:EF-hand_2 5 118 8.2e-14 PFAM
Pfam:EF-hand_3 123 217 7.2e-20 PFAM
ZnF_ZZ 222 267 7.34e-13 SMART
coiled coil region 382 411 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.2%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,692,709 *160Q probably null Het
Aen G A 7: 78,907,394 G330E probably benign Het
Akap8l G A 17: 32,336,320 R262C probably damaging Het
Cbx8 G A 11: 119,038,868 Q300* probably null Het
Cd274 C T 19: 29,385,408 T290M probably damaging Het
Cd36 A C 5: 17,814,723 S127A probably damaging Het
Celf3 A G 3: 94,480,286 Y55C probably damaging Het
Clec1a A T 6: 129,435,353 probably null Het
Cog2 A T 8: 124,550,306 I684F probably damaging Het
Cyp2c65 C T 19: 39,061,114 L29F possibly damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Flg A G 3: 93,279,921 T227A probably benign Het
Heatr4 T A 12: 83,955,010 K887M probably null Het
Hoxb1 C T 11: 96,365,992 Q56* probably null Het
Kcnh7 T A 2: 62,739,344 N736I probably damaging Het
Lgr4 T C 2: 109,991,133 V120A probably damaging Het
Ltbp1 A G 17: 75,151,402 Y326C possibly damaging Het
Map3k1 A T 13: 111,755,725 S999T probably damaging Het
Med12l T C 3: 59,247,911 F1171L probably damaging Het
Muc5b T C 7: 141,858,665 S1783P unknown Het
Nbr1 T C 11: 101,565,774 L159P probably damaging Het
Nme9 T C 9: 99,469,707 F248S possibly damaging Het
Olfr1265 C T 2: 90,037,395 L159F probably benign Het
Olfr420 T C 1: 174,159,264 S164P probably damaging Het
Rasgrf1 C T 9: 89,991,630 T664I probably damaging Het
Setx A G 2: 29,130,274 D91G probably damaging Het
Stim1 A G 7: 102,430,950 R514G probably null Het
Svep1 C A 4: 58,049,169 G3446V probably damaging Het
Tcte2 T A 17: 13,722,452 probably benign Het
Trmt10b A G 4: 45,308,562 K239E probably damaging Het
Wdr70 A T 15: 8,042,841 S189T probably benign Het
Other mutations in Dytn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Dytn APN 1 63678840 missense probably benign 0.34
IGL00870:Dytn APN 1 63677113 splice site probably benign
IGL02110:Dytn APN 1 63647473 missense possibly damaging 0.86
IGL02124:Dytn APN 1 63641092 missense probably damaging 1.00
IGL02211:Dytn APN 1 63674930 missense possibly damaging 0.61
IGL02712:Dytn APN 1 63664422 missense probably benign 0.00
IGL02832:Dytn APN 1 63643373 missense probably benign 0.45
IGL03036:Dytn APN 1 63641122 missense probably damaging 0.97
H8562:Dytn UTSW 1 63674912 missense possibly damaging 0.88
R0306:Dytn UTSW 1 63685113 missense possibly damaging 0.89
R0441:Dytn UTSW 1 63678774 splice site probably benign
R1453:Dytn UTSW 1 63633873 missense probably damaging 0.99
R1655:Dytn UTSW 1 63661198 missense probably damaging 1.00
R1892:Dytn UTSW 1 63677261 missense probably benign 0.04
R3030:Dytn UTSW 1 63633519 missense probably benign 0.04
R4062:Dytn UTSW 1 63647447 missense probably benign 0.05
R4640:Dytn UTSW 1 63643348 missense possibly damaging 0.52
R4804:Dytn UTSW 1 63643366 missense probably benign 0.08
R4931:Dytn UTSW 1 63633678 missense probably benign 0.26
R5015:Dytn UTSW 1 63633695 missense probably benign 0.00
R5054:Dytn UTSW 1 63661159 missense possibly damaging 0.64
R5120:Dytn UTSW 1 63623043 missense probably benign
R5888:Dytn UTSW 1 63677237 missense possibly damaging 0.91
R6243:Dytn UTSW 1 63647521 missense possibly damaging 0.76
R7595:Dytn UTSW 1 63659002 missense probably damaging 0.99
R7705:Dytn UTSW 1 63678789 missense probably damaging 1.00
Z1177:Dytn UTSW 1 63633454
Predicted Primers PCR Primer
(F):5'- AGACTTCCAGGTAGTCCAGG -3'
(R):5'- CTCTGAAGAGGGTTAAAGCTGG -3'

Sequencing Primer
(F):5'- TAGTCCAGGTAGACAGTAGCTCTC -3'
(R):5'- TGTAATGAACACAAAGGCTATCTACC -3'
Posted On2018-05-04