Incidental Mutation 'R6400:Olfr420'
ID516116
Institutional Source Beutler Lab
Gene Symbol Olfr420
Ensembl Gene ENSMUSG00000055033
Gene Nameolfactory receptor 420
SynonymsGA_x6K02T2P20D-20995211-20994246, MOR105-10
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R6400 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location174155633-174162195 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 174159264 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 164 (S164P)
Ref Sequence ENSEMBL: ENSMUSP00000149052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068403] [ENSMUST00000213748]
Predicted Effect probably damaging
Transcript: ENSMUST00000068403
AA Change: S164P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000069662
Gene: ENSMUSG00000055033
AA Change: S164P

DomainStartEndE-ValueType
Pfam:7tm_4 31 310 9.9e-60 PFAM
Pfam:7tm_1 41 292 4.1e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213748
AA Change: S164P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Meta Mutation Damage Score 0.2548 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.2%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,692,709 *160Q probably null Het
Aen G A 7: 78,907,394 G330E probably benign Het
Akap8l G A 17: 32,336,320 R262C probably damaging Het
Cbx8 G A 11: 119,038,868 Q300* probably null Het
Cd274 C T 19: 29,385,408 T290M probably damaging Het
Cd36 A C 5: 17,814,723 S127A probably damaging Het
Celf3 A G 3: 94,480,286 Y55C probably damaging Het
Clec1a A T 6: 129,435,353 probably null Het
Cog2 A T 8: 124,550,306 I684F probably damaging Het
Cyp2c65 C T 19: 39,061,114 L29F possibly damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Dytn A T 1: 63,641,176 L408* probably null Het
Flg A G 3: 93,279,921 T227A probably benign Het
Heatr4 T A 12: 83,955,010 K887M probably null Het
Hoxb1 C T 11: 96,365,992 Q56* probably null Het
Kcnh7 T A 2: 62,739,344 N736I probably damaging Het
Lgr4 T C 2: 109,991,133 V120A probably damaging Het
Ltbp1 A G 17: 75,151,402 Y326C possibly damaging Het
Map3k1 A T 13: 111,755,725 S999T probably damaging Het
Med12l T C 3: 59,247,911 F1171L probably damaging Het
Muc5b T C 7: 141,858,665 S1783P unknown Het
Nbr1 T C 11: 101,565,774 L159P probably damaging Het
Nme9 T C 9: 99,469,707 F248S possibly damaging Het
Olfr1265 C T 2: 90,037,395 L159F probably benign Het
Rasgrf1 C T 9: 89,991,630 T664I probably damaging Het
Setx A G 2: 29,130,274 D91G probably damaging Het
Stim1 A G 7: 102,430,950 R514G probably null Het
Svep1 C A 4: 58,049,169 G3446V probably damaging Het
Tcte2 T A 17: 13,722,452 probably benign Het
Trmt10b A G 4: 45,308,562 K239E probably damaging Het
Wdr70 A T 15: 8,042,841 S189T probably benign Het
Other mutations in Olfr420
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Olfr420 APN 1 174158857 missense probably damaging 1.00
IGL02479:Olfr420 APN 1 174158954 nonsense probably null
IGL03190:Olfr420 APN 1 174159544 missense probably damaging 0.99
IGL03270:Olfr420 APN 1 174159553 missense probably benign 0.04
R0645:Olfr420 UTSW 1 174159354 missense probably benign 0.00
R0834:Olfr420 UTSW 1 174159364 missense possibly damaging 0.55
R1432:Olfr420 UTSW 1 174158917 missense possibly damaging 0.67
R1508:Olfr420 UTSW 1 174159364 missense possibly damaging 0.55
R2351:Olfr420 UTSW 1 174158920 missense probably damaging 0.99
R3440:Olfr420 UTSW 1 174159180 missense probably benign 0.14
R3441:Olfr420 UTSW 1 174159180 missense probably benign 0.14
R4571:Olfr420 UTSW 1 174158928 missense possibly damaging 0.77
R5072:Olfr420 UTSW 1 174158961 missense probably damaging 1.00
R6060:Olfr420 UTSW 1 174159341 nonsense probably null
R6166:Olfr420 UTSW 1 174159093 missense probably benign 0.43
R6228:Olfr420 UTSW 1 174152146 missense probably benign 0.00
R6272:Olfr420 UTSW 1 174159175 missense probably benign 0.02
R6298:Olfr420 UTSW 1 174152182 missense probably benign 0.02
R7581:Olfr420 UTSW 1 174158771 splice site probably null
R7677:Olfr420 UTSW 1 174159048 missense probably damaging 1.00
R7823:Olfr420 UTSW 1 174159688 missense probably benign 0.12
R7829:Olfr420 UTSW 1 174158859 missense probably benign 0.00
R8077:Olfr420 UTSW 1 174151845 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGGCATCAGTGAGGTTTGTC -3'
(R):5'- AAAATGCTTTACGGCGGCC -3'

Sequencing Primer
(F):5'- GTCTCTTGACAGCTATGGCC -3'
(R):5'- TTCAGCTGAACGGATGCG -3'
Posted On2018-05-04