Incidental Mutation 'R6400:Olfr1265'
ID516119
Institutional Source Beutler Lab
Gene Symbol Olfr1265
Ensembl Gene ENSMUSG00000059910
Gene Nameolfactory receptor 1265
SynonymsGA_x6K02T2Q125-51469027-51469956, MOR228-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6400 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location90035337-90042214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 90037395 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 159 (L159F)
Ref Sequence ENSEMBL: ENSMUSP00000149684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080311] [ENSMUST00000214855]
Predicted Effect probably benign
Transcript: ENSMUST00000080311
AA Change: L159F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000079190
Gene: ENSMUSG00000059910
AA Change: L159F

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.9e-49 PFAM
Pfam:7tm_1 39 285 1.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214855
AA Change: L159F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.1422 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.2%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,692,709 *160Q probably null Het
Aen G A 7: 78,907,394 G330E probably benign Het
Akap8l G A 17: 32,336,320 R262C probably damaging Het
Cbx8 G A 11: 119,038,868 Q300* probably null Het
Cd274 C T 19: 29,385,408 T290M probably damaging Het
Cd36 A C 5: 17,814,723 S127A probably damaging Het
Celf3 A G 3: 94,480,286 Y55C probably damaging Het
Clec1a A T 6: 129,435,353 probably null Het
Cog2 A T 8: 124,550,306 I684F probably damaging Het
Cyp2c65 C T 19: 39,061,114 L29F possibly damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Dytn A T 1: 63,641,176 L408* probably null Het
Flg A G 3: 93,279,921 T227A probably benign Het
Heatr4 T A 12: 83,955,010 K887M probably null Het
Hoxb1 C T 11: 96,365,992 Q56* probably null Het
Kcnh7 T A 2: 62,739,344 N736I probably damaging Het
Lgr4 T C 2: 109,991,133 V120A probably damaging Het
Ltbp1 A G 17: 75,151,402 Y326C possibly damaging Het
Map3k1 A T 13: 111,755,725 S999T probably damaging Het
Med12l T C 3: 59,247,911 F1171L probably damaging Het
Muc5b T C 7: 141,858,665 S1783P unknown Het
Nbr1 T C 11: 101,565,774 L159P probably damaging Het
Nme9 T C 9: 99,469,707 F248S possibly damaging Het
Olfr420 T C 1: 174,159,264 S164P probably damaging Het
Rasgrf1 C T 9: 89,991,630 T664I probably damaging Het
Setx A G 2: 29,130,274 D91G probably damaging Het
Stim1 A G 7: 102,430,950 R514G probably null Het
Svep1 C A 4: 58,049,169 G3446V probably damaging Het
Tcte2 T A 17: 13,722,452 probably benign Het
Trmt10b A G 4: 45,308,562 K239E probably damaging Het
Wdr70 A T 15: 8,042,841 S189T probably benign Het
Other mutations in Olfr1265
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Olfr1265 APN 2 90037468 missense probably damaging 1.00
IGL01470:Olfr1265 APN 2 90037818 missense possibly damaging 0.81
IGL01878:Olfr1265 APN 2 90037134 missense probably damaging 0.97
IGL02716:Olfr1265 APN 2 90037794 missense probably benign 0.05
IGL03066:Olfr1265 APN 2 90037434 missense probably damaging 0.99
R1310:Olfr1265 UTSW 2 90037703 missense probably benign 0.02
R4986:Olfr1265 UTSW 2 90037428 missense probably damaging 1.00
R5101:Olfr1265 UTSW 2 90037047 missense probably benign 0.00
R6149:Olfr1265 UTSW 2 90037516 missense probably benign 0.01
R7367:Olfr1265 UTSW 2 90037812 missense probably benign 0.02
R7432:Olfr1265 UTSW 2 90037184 missense probably damaging 0.99
R7645:Olfr1265 UTSW 2 90037747 missense possibly damaging 0.90
R7849:Olfr1265 UTSW 2 90037282 missense probably damaging 1.00
X0019:Olfr1265 UTSW 2 90037644 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGTATGGGGCTGCATGACAC -3'
(R):5'- AGCACTCTGAGTTCTTAGATGG -3'

Sequencing Primer
(F):5'- GCATGACACAGCTTTTCTTCATG -3'
(R):5'- ACAAGATGACCACATAGGATGC -3'
Posted On2018-05-04