Incidental Mutation 'R6400:Trmt10b'
ID516124
Institutional Source Beutler Lab
Gene Symbol Trmt10b
Ensembl Gene ENSMUSG00000035601
Gene NametRNA methyltransferase 10B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R6400 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location45297127-45316131 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45308562 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 239 (K239E)
Ref Sequence ENSEMBL: ENSMUSP00000103429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044673] [ENSMUST00000107800] [ENSMUST00000144781]
Predicted Effect probably damaging
Transcript: ENSMUST00000044673
AA Change: K241E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041052
Gene: ENSMUSG00000035601
AA Change: K241E

DomainStartEndE-ValueType
low complexity region 76 95 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
Pfam:tRNA_m1G_MT 135 308 2.6e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107800
AA Change: K239E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103429
Gene: ENSMUSG00000035601
AA Change: K239E

DomainStartEndE-ValueType
low complexity region 76 95 N/A INTRINSIC
low complexity region 108 120 N/A INTRINSIC
Pfam:tRNA_m1G_MT 133 306 1.6e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141659
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142785
Predicted Effect probably benign
Transcript: ENSMUST00000144781
SMART Domains Protein: ENSMUSP00000114832
Gene: ENSMUSG00000035601

DomainStartEndE-ValueType
low complexity region 76 95 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
Meta Mutation Damage Score 0.6656 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.2%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,692,709 *160Q probably null Het
Aen G A 7: 78,907,394 G330E probably benign Het
Akap8l G A 17: 32,336,320 R262C probably damaging Het
Cbx8 G A 11: 119,038,868 Q300* probably null Het
Cd274 C T 19: 29,385,408 T290M probably damaging Het
Cd36 A C 5: 17,814,723 S127A probably damaging Het
Celf3 A G 3: 94,480,286 Y55C probably damaging Het
Clec1a A T 6: 129,435,353 probably null Het
Cog2 A T 8: 124,550,306 I684F probably damaging Het
Cyp2c65 C T 19: 39,061,114 L29F possibly damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Dytn A T 1: 63,641,176 L408* probably null Het
Flg A G 3: 93,279,921 T227A probably benign Het
Heatr4 T A 12: 83,955,010 K887M probably null Het
Hoxb1 C T 11: 96,365,992 Q56* probably null Het
Kcnh7 T A 2: 62,739,344 N736I probably damaging Het
Lgr4 T C 2: 109,991,133 V120A probably damaging Het
Ltbp1 A G 17: 75,151,402 Y326C possibly damaging Het
Map3k1 A T 13: 111,755,725 S999T probably damaging Het
Med12l T C 3: 59,247,911 F1171L probably damaging Het
Muc5b T C 7: 141,858,665 S1783P unknown Het
Nbr1 T C 11: 101,565,774 L159P probably damaging Het
Nme9 T C 9: 99,469,707 F248S possibly damaging Het
Olfr1265 C T 2: 90,037,395 L159F probably benign Het
Olfr420 T C 1: 174,159,264 S164P probably damaging Het
Rasgrf1 C T 9: 89,991,630 T664I probably damaging Het
Setx A G 2: 29,130,274 D91G probably damaging Het
Stim1 A G 7: 102,430,950 R514G probably null Het
Svep1 C A 4: 58,049,169 G3446V probably damaging Het
Tcte2 T A 17: 13,722,452 probably benign Het
Wdr70 A T 15: 8,042,841 S189T probably benign Het
Other mutations in Trmt10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Trmt10b APN 4 45314347 missense possibly damaging 0.91
IGL01743:Trmt10b APN 4 45305879 missense probably damaging 1.00
IGL02012:Trmt10b APN 4 45315045 missense probably benign 0.00
IGL02174:Trmt10b APN 4 45308508 missense possibly damaging 0.88
R0454:Trmt10b UTSW 4 45304286 missense probably damaging 1.00
R0506:Trmt10b UTSW 4 45304306 missense probably damaging 0.98
R1757:Trmt10b UTSW 4 45307946 missense probably damaging 1.00
R1962:Trmt10b UTSW 4 45314378 nonsense probably null
R2944:Trmt10b UTSW 4 45300445 start codon destroyed probably null 0.99
R4781:Trmt10b UTSW 4 45305817 missense probably damaging 0.98
R5802:Trmt10b UTSW 4 45314236 unclassified probably benign
R6460:Trmt10b UTSW 4 45314322 missense possibly damaging 0.81
R7165:Trmt10b UTSW 4 45308549 missense probably damaging 1.00
R7182:Trmt10b UTSW 4 45308520 missense probably benign 0.36
R8399:Trmt10b UTSW 4 45305870 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- CCAGCAGGCTTTAAGTTGTG -3'
(R):5'- GCAAATGCCTCTACTGTACATGG -3'

Sequencing Primer
(F):5'- CAGCAGGCTTTAAGTTGTGTTGTTG -3'
(R):5'- AACGGCTGGAAGTTCCTG -3'
Posted On2018-05-04