Incidental Mutation 'R6400:Cd36'
ID516126
Institutional Source Beutler Lab
Gene Symbol Cd36
Ensembl Gene ENSMUSG00000002944
Gene NameCD36 molecule
Synonymsfatty acid translocase, FAT, Scarb3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R6400 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location17781690-17888801 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 17814723 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 127 (S127A)
Ref Sequence ENSEMBL: ENSMUSP00000143061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082367] [ENSMUST00000165232] [ENSMUST00000169095] [ENSMUST00000170051] [ENSMUST00000197574] [ENSMUST00000197890]
Predicted Effect probably damaging
Transcript: ENSMUST00000082367
AA Change: S127A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080974
Gene: ENSMUSG00000002944
AA Change: S127A

DomainStartEndE-ValueType
Pfam:CD36 14 463 2.5e-151 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165232
AA Change: S127A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126300
Gene: ENSMUSG00000002944
AA Change: S127A

DomainStartEndE-ValueType
Pfam:CD36 12 465 2.5e-149 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169095
AA Change: S127A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131832
Gene: ENSMUSG00000002944
AA Change: S127A

DomainStartEndE-ValueType
Pfam:CD36 12 465 2.5e-149 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170051
AA Change: S127A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133008
Gene: ENSMUSG00000002944
AA Change: S127A

DomainStartEndE-ValueType
Pfam:CD36 12 465 2.5e-149 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000197574
AA Change: S127A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143107
Gene: ENSMUSG00000002944
AA Change: S127A

DomainStartEndE-ValueType
Pfam:CD36 12 142 1.8e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000197890
AA Change: S127A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143061
Gene: ENSMUSG00000002944
AA Change: S127A

DomainStartEndE-ValueType
Pfam:CD36 12 465 2.5e-149 PFAM
Meta Mutation Damage Score 0.1841 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.2%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the fourth major glycoprotein of the platelet surface and serves as a receptor for thrombospondin in platelets and various cell lines. Since thrombospondins are widely distributed proteins involved in a variety of adhesive processes, this protein may have important functions as a cell adhesion molecule. It binds to collagen, thrombospondin, anionic phospholipids and oxidized LDL. It directly mediates cytoadherence of Plasmodium falciparum parasitized erythrocytes and it binds long chain fatty acids and may function in the transport and/or as a regulator of fatty acid transport. Mutations in this gene cause platelet glycoprotein deficiency. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant mice exhibit an immunodeficiency phenotype, are susceptible to S. aureus infection and develop ocular pterygium. Mice homozygous for disruptions in this gene display abnormal lipid homeostasis which affects energy utilization in the heart. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,692,709 *160Q probably null Het
Aen G A 7: 78,907,394 G330E probably benign Het
Akap8l G A 17: 32,336,320 R262C probably damaging Het
Cbx8 G A 11: 119,038,868 Q300* probably null Het
Cd274 C T 19: 29,385,408 T290M probably damaging Het
Celf3 A G 3: 94,480,286 Y55C probably damaging Het
Clec1a A T 6: 129,435,353 probably null Het
Cog2 A T 8: 124,550,306 I684F probably damaging Het
Cyp2c65 C T 19: 39,061,114 L29F possibly damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Dytn A T 1: 63,641,176 L408* probably null Het
Flg A G 3: 93,279,921 T227A probably benign Het
Heatr4 T A 12: 83,955,010 K887M probably null Het
Hoxb1 C T 11: 96,365,992 Q56* probably null Het
Kcnh7 T A 2: 62,739,344 N736I probably damaging Het
Lgr4 T C 2: 109,991,133 V120A probably damaging Het
Ltbp1 A G 17: 75,151,402 Y326C possibly damaging Het
Map3k1 A T 13: 111,755,725 S999T probably damaging Het
Med12l T C 3: 59,247,911 F1171L probably damaging Het
Muc5b T C 7: 141,858,665 S1783P unknown Het
Nbr1 T C 11: 101,565,774 L159P probably damaging Het
Nme9 T C 9: 99,469,707 F248S possibly damaging Het
Olfr1265 C T 2: 90,037,395 L159F probably benign Het
Olfr420 T C 1: 174,159,264 S164P probably damaging Het
Rasgrf1 C T 9: 89,991,630 T664I probably damaging Het
Setx A G 2: 29,130,274 D91G probably damaging Het
Stim1 A G 7: 102,430,950 R514G probably null Het
Svep1 C A 4: 58,049,169 G3446V probably damaging Het
Tcte2 T A 17: 13,722,452 probably benign Het
Trmt10b A G 4: 45,308,562 K239E probably damaging Het
Wdr70 A T 15: 8,042,841 S189T probably benign Het
Other mutations in Cd36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Cd36 APN 5 17787702 missense probably damaging 0.99
IGL01355:Cd36 APN 5 17813074 missense possibly damaging 0.76
IGL02140:Cd36 APN 5 17828768 splice site probably benign
IGL02385:Cd36 APN 5 17814719 missense probably benign 0.31
IGL02626:Cd36 APN 5 17797128 nonsense probably null
IGL02645:Cd36 APN 5 17785880 missense probably benign 0.01
IGL03149:Cd36 APN 5 17820565 missense probably benign 0.02
detached UTSW 5 17814723 missense probably damaging 1.00
oblivious UTSW 5 17874966 intron probably benign
E0370:Cd36 UTSW 5 17785749 nonsense probably null
F5770:Cd36 UTSW 5 17820528 frame shift probably null
R0266:Cd36 UTSW 5 17798252 missense probably benign 0.09
R1102:Cd36 UTSW 5 17814213 missense possibly damaging 0.79
R1120:Cd36 UTSW 5 17785828 missense possibly damaging 0.67
R1170:Cd36 UTSW 5 17813088 missense probably damaging 1.00
R1551:Cd36 UTSW 5 17797122 missense probably benign 0.00
R1918:Cd36 UTSW 5 17797036 nonsense probably null
R4090:Cd36 UTSW 5 17785720 critical splice donor site probably null
R4197:Cd36 UTSW 5 17813088 missense probably damaging 1.00
R5602:Cd36 UTSW 5 17814792 missense possibly damaging 0.94
R5647:Cd36 UTSW 5 17814765 missense probably damaging 1.00
R5867:Cd36 UTSW 5 17785735 missense probably benign 0.05
R6151:Cd36 UTSW 5 17795595 missense probably damaging 1.00
R6419:Cd36 UTSW 5 17797152 missense probably benign
R7081:Cd36 UTSW 5 17814704 missense probably damaging 1.00
R7195:Cd36 UTSW 5 17814189 missense probably damaging 1.00
R7420:Cd36 UTSW 5 17788274 missense probably benign 0.09
V7580:Cd36 UTSW 5 17820528 frame shift probably null
Z1088:Cd36 UTSW 5 17795575 splice site probably null
Predicted Primers PCR Primer
(F):5'- GGCTGATTGGGTCATCTATCCAG -3'
(R):5'- GCCAGAGATGTCTCACTAGCTAATC -3'

Sequencing Primer
(F):5'- CTGATTGGGTCATCTATCCAGATAAC -3'
(R):5'- GTCTCACTAGCTAATCATTTACCATG -3'
Posted On2018-05-04