Incidental Mutation 'R6400:Clec1a'
ID516127
Institutional Source Beutler Lab
Gene Symbol Clec1a
Ensembl Gene ENSMUSG00000033082
Gene NameC-type lectin domain family 1, member a
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6400 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location129424772-129452000 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 129435353 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037481] [ENSMUST00000203162] [ENSMUST00000204012] [ENSMUST00000204952]
Predicted Effect probably null
Transcript: ENSMUST00000037481
SMART Domains Protein: ENSMUSP00000047065
Gene: ENSMUSG00000033082

DomainStartEndE-ValueType
Blast:CLECT 1 48 9e-23 BLAST
transmembrane domain 49 71 N/A INTRINSIC
coiled coil region 82 120 N/A INTRINSIC
CLECT 136 257 7.55e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000203162
SMART Domains Protein: ENSMUSP00000144896
Gene: ENSMUSG00000033082

DomainStartEndE-ValueType
Blast:CLECT 1 48 1e-23 BLAST
transmembrane domain 50 72 N/A INTRINSIC
coiled coil region 82 120 N/A INTRINSIC
CLECT 136 205 5.1e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000204012
SMART Domains Protein: ENSMUSP00000145071
Gene: ENSMUSG00000033082

DomainStartEndE-ValueType
Blast:CLECT 1 37 3e-16 BLAST
coiled coil region 49 87 N/A INTRINSIC
PDB:1MPU|A 100 146 2e-9 PDB
SCOP:d1k9ja_ 100 146 3e-13 SMART
Blast:CLECT 103 165 2e-42 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000204952
SMART Domains Protein: ENSMUSP00000145497
Gene: ENSMUSG00000033082

DomainStartEndE-ValueType
Blast:CLECT 1 41 1e-17 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.2%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signaling, glycoprotein turnover, and roles in inflammation and immune response. The encoded protein may play a role in regulating dendritic cell function. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,692,709 *160Q probably null Het
Aen G A 7: 78,907,394 G330E probably benign Het
Akap8l G A 17: 32,336,320 R262C probably damaging Het
Cbx8 G A 11: 119,038,868 Q300* probably null Het
Cd274 C T 19: 29,385,408 T290M probably damaging Het
Cd36 A C 5: 17,814,723 S127A probably damaging Het
Celf3 A G 3: 94,480,286 Y55C probably damaging Het
Cog2 A T 8: 124,550,306 I684F probably damaging Het
Cyp2c65 C T 19: 39,061,114 L29F possibly damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Dytn A T 1: 63,641,176 L408* probably null Het
Flg A G 3: 93,279,921 T227A probably benign Het
Heatr4 T A 12: 83,955,010 K887M probably null Het
Hoxb1 C T 11: 96,365,992 Q56* probably null Het
Kcnh7 T A 2: 62,739,344 N736I probably damaging Het
Lgr4 T C 2: 109,991,133 V120A probably damaging Het
Ltbp1 A G 17: 75,151,402 Y326C possibly damaging Het
Map3k1 A T 13: 111,755,725 S999T probably damaging Het
Med12l T C 3: 59,247,911 F1171L probably damaging Het
Muc5b T C 7: 141,858,665 S1783P unknown Het
Nbr1 T C 11: 101,565,774 L159P probably damaging Het
Nme9 T C 9: 99,469,707 F248S possibly damaging Het
Olfr1265 C T 2: 90,037,395 L159F probably benign Het
Olfr420 T C 1: 174,159,264 S164P probably damaging Het
Rasgrf1 C T 9: 89,991,630 T664I probably damaging Het
Setx A G 2: 29,130,274 D91G probably damaging Het
Stim1 A G 7: 102,430,950 R514G probably null Het
Svep1 C A 4: 58,049,169 G3446V probably damaging Het
Tcte2 T A 17: 13,722,452 probably benign Het
Trmt10b A G 4: 45,308,562 K239E probably damaging Het
Wdr70 A T 15: 8,042,841 S189T probably benign Het
Other mutations in Clec1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
Truck UTSW 6 129436955 missense probably damaging 1.00
Turnip UTSW 6 129429983 missense probably benign 0.21
R1666:Clec1a UTSW 6 129437004 missense probably benign 0.07
R2413:Clec1a UTSW 6 129435255 missense probably damaging 1.00
R6921:Clec1a UTSW 6 129428864 missense probably damaging 1.00
R6961:Clec1a UTSW 6 129429983 missense probably benign 0.21
R7218:Clec1a UTSW 6 129436955 missense probably damaging 1.00
R7944:Clec1a UTSW 6 129432187 missense probably benign
R7945:Clec1a UTSW 6 129432187 missense probably benign
Z1177:Clec1a UTSW 6 129429907 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CCTGCTGTAGAGTTTCAATGAGTTTTC -3'
(R):5'- GCAAGGATACAGATTGGTATTGAGTTC -3'

Sequencing Primer
(F):5'- CTGTTCTGGGCCTGGAGAGAC -3'
(R):5'- TTTCGAAGATCATATGCCCCAG -3'
Posted On2018-05-04