Incidental Mutation 'R6400:Aen'
ID516129
Institutional Source Beutler Lab
Gene Symbol Aen
Ensembl Gene ENSMUSG00000030609
Gene Nameapoptosis enhancing nuclease
SynonymsIsg20l1, 2700083B06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R6400 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location78895854-78911209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 78907394 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 330 (G330E)
Ref Sequence ENSEMBL: ENSMUSP00000103048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107421] [ENSMUST00000107423] [ENSMUST00000107425] [ENSMUST00000138167] [ENSMUST00000205861]
Predicted Effect probably benign
Transcript: ENSMUST00000107421
AA Change: G292E

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000103044
Gene: ENSMUSG00000030609
AA Change: G292E

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
EXOIII 70 236 2.04e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107423
AA Change: G330E

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000103046
Gene: ENSMUSG00000030609
AA Change: G330E

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
EXOIII 108 274 2.04e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107425
AA Change: G330E

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000103048
Gene: ENSMUSG00000030609
AA Change: G330E

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
EXOIII 108 274 2.04e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123824
Predicted Effect probably benign
Transcript: ENSMUST00000138167
SMART Domains Protein: ENSMUSP00000117331
Gene: ENSMUSG00000030609

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
Pfam:RNase_T 72 138 1.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205861
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206661
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.2%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,692,709 *160Q probably null Het
Akap8l G A 17: 32,336,320 R262C probably damaging Het
Cbx8 G A 11: 119,038,868 Q300* probably null Het
Cd274 C T 19: 29,385,408 T290M probably damaging Het
Cd36 A C 5: 17,814,723 S127A probably damaging Het
Celf3 A G 3: 94,480,286 Y55C probably damaging Het
Clec1a A T 6: 129,435,353 probably null Het
Cog2 A T 8: 124,550,306 I684F probably damaging Het
Cyp2c65 C T 19: 39,061,114 L29F possibly damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Dytn A T 1: 63,641,176 L408* probably null Het
Flg A G 3: 93,279,921 T227A probably benign Het
Heatr4 T A 12: 83,955,010 K887M probably null Het
Hoxb1 C T 11: 96,365,992 Q56* probably null Het
Kcnh7 T A 2: 62,739,344 N736I probably damaging Het
Lgr4 T C 2: 109,991,133 V120A probably damaging Het
Ltbp1 A G 17: 75,151,402 Y326C possibly damaging Het
Map3k1 A T 13: 111,755,725 S999T probably damaging Het
Med12l T C 3: 59,247,911 F1171L probably damaging Het
Muc5b T C 7: 141,858,665 S1783P unknown Het
Nbr1 T C 11: 101,565,774 L159P probably damaging Het
Nme9 T C 9: 99,469,707 F248S possibly damaging Het
Olfr1265 C T 2: 90,037,395 L159F probably benign Het
Olfr420 T C 1: 174,159,264 S164P probably damaging Het
Rasgrf1 C T 9: 89,991,630 T664I probably damaging Het
Setx A G 2: 29,130,274 D91G probably damaging Het
Stim1 A G 7: 102,430,950 R514G probably null Het
Svep1 C A 4: 58,049,169 G3446V probably damaging Het
Tcte2 T A 17: 13,722,452 probably benign Het
Trmt10b A G 4: 45,308,562 K239E probably damaging Het
Wdr70 A T 15: 8,042,841 S189T probably benign Het
Other mutations in Aen
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Aen APN 7 78907302 missense probably damaging 0.96
IGL01062:Aen APN 7 78907302 missense probably damaging 0.96
IGL01065:Aen APN 7 78907302 missense probably damaging 0.96
IGL01067:Aen APN 7 78907302 missense probably damaging 0.96
IGL01068:Aen APN 7 78907302 missense probably damaging 0.96
IGL01069:Aen APN 7 78907302 missense probably damaging 0.96
IGL01070:Aen APN 7 78907302 missense probably damaging 0.96
IGL01086:Aen APN 7 78907302 missense probably damaging 0.96
IGL01089:Aen APN 7 78907302 missense probably damaging 0.96
IGL01126:Aen APN 7 78907302 missense probably damaging 0.96
IGL01128:Aen APN 7 78907302 missense probably damaging 0.96
IGL01133:Aen APN 7 78907302 missense probably damaging 0.96
IGL01134:Aen APN 7 78907302 missense probably damaging 0.96
IGL01147:Aen APN 7 78907302 missense probably damaging 0.96
R1433:Aen UTSW 7 78907312 missense probably damaging 1.00
R1543:Aen UTSW 7 78902622 missense probably damaging 1.00
R1615:Aen UTSW 7 78905912 missense probably damaging 1.00
R1886:Aen UTSW 7 78907325 missense probably damaging 0.98
R1887:Aen UTSW 7 78907325 missense probably damaging 0.98
R1918:Aen UTSW 7 78906029 missense possibly damaging 0.96
R1919:Aen UTSW 7 78905912 missense probably damaging 1.00
R1946:Aen UTSW 7 78902672 missense probably damaging 1.00
R2192:Aen UTSW 7 78906045 critical splice donor site probably null
R2224:Aen UTSW 7 78902451 missense probably benign 0.30
R2225:Aen UTSW 7 78902451 missense probably benign 0.30
R2226:Aen UTSW 7 78902451 missense probably benign 0.30
R2244:Aen UTSW 7 78907297 missense probably damaging 1.00
R2516:Aen UTSW 7 78905868 missense probably damaging 1.00
R4943:Aen UTSW 7 78902361 missense probably damaging 0.99
R5634:Aen UTSW 7 78902507 missense probably benign 0.01
R5834:Aen UTSW 7 78907301 missense probably damaging 1.00
R5961:Aen UTSW 7 78907159 missense probably damaging 1.00
R6130:Aen UTSW 7 78902639 splice site probably null
R6255:Aen UTSW 7 78905844 missense probably damaging 1.00
R7303:Aen UTSW 7 78902456 missense possibly damaging 0.77
R8207:Aen UTSW 7 78902743 missense possibly damaging 0.55
Z1177:Aen UTSW 7 78902766 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CATGGAGTTGTACCAGCTGG -3'
(R):5'- ACCAGTGCCCTTAAGTTACC -3'

Sequencing Primer
(F):5'- CAGCTGGTGGAGGTGCAG -3'
(R):5'- ACAGTTCCTCATGCTGTGGAGAC -3'
Posted On2018-05-04