Mutagenetix > Incidental Mutation

Incidental Mutation 'R6400:Rasgrf1'

516132

Institutional Source

Beutler Lab

Gene Symbol

Rasgrf1

Ensembl Gene

ENSMUSG00000032356

Gene Name

RAS protein-specific guanine nucleotide-releasing factor 1

Synonyms

Grf1, CDC25Mm, Grfbeta, CDC25

MMRRC Submission

044547-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6400 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

89791961-89909030 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 89873683 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 664 (T664I)

Ref Sequence

ENSEMBL: ENSMUSP00000034912 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034912]

AlphaFold

P27671

PDB Structure

Crystal Structure of the Cdc25 domain of RasGRF1 [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034912
AA Change: T664I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034912
Gene: ENSMUSG00000032356
AA Change: T664I

Domain	Start	End	E-Value	Type
PH	23	132	2.48e-18	SMART
Blast:RhoGEF	146	196	4e-6	BLAST
IQ	205	227	5.27e0	SMART
RhoGEF	248	429	1.96e-57	SMART
PH	461	590	1.51e-8	SMART
RasGEFN	634	767	3.07e-10	SMART
low complexity region	844	855	N/A	INTRINSIC
RasGEFN	869	997	5.86e-7	SMART
RasGEF	1023	1260	1.85e-99	SMART

Meta Mutation Damage Score

0.3907

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 99.0%
20x: 96.2%

Validation Efficiency

100% (32/32)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor (GEF) similar to the Saccharomyces cerevisiae CDC25 gene product. Functional analysis has demonstrated that this protein stimulates the dissociation of GDP from RAS protein. The studies of the similar gene in mouse suggested that the Ras-GEF activity of this protein in brain can be activated by Ca2+ influx, muscarinic receptors, and G protein beta-gamma subunit. Mouse studies also indicated that the Ras-GEF signaling pathway mediated by this protein may be important for long-term memory. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for null mutations (and heterozygotes with a paternally inherited mutant allele) exhibit reduced postnatal growth, low insulin and IGF I levels, glucose intolerance, beta-cell hypoplasia, impaired long-term synaptic plasticity, and impaired hippocampal-dependent learning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc9	A	G	6: 142,638,435 (GRCm39)	*160Q	probably null	Het
Aen	G	A	7: 78,557,142 (GRCm39)	G330E	probably benign	Het
Akap8l	G	A	17: 32,555,294 (GRCm39)	R262C	probably damaging	Het
Cbx8	G	A	11: 118,929,694 (GRCm39)	Q300*	probably null	Het
Cd274	C	T	19: 29,362,808 (GRCm39)	T290M	probably damaging	Het
Cd36	A	C	5: 18,019,721 (GRCm39)	S127A	probably damaging	Het
Celf3	A	G	3: 94,387,593 (GRCm39)	Y55C	probably damaging	Het
Clec1a	A	T	6: 129,412,316 (GRCm39)		probably null	Het
Cog2	A	T	8: 125,277,045 (GRCm39)	I684F	probably damaging	Het
Cyp2c65	C	T	19: 39,049,558 (GRCm39)	L29F	possibly damaging	Het
Dnajc14	A	G	10: 128,643,359 (GRCm39)	E427G	probably damaging	Het
Dytn	A	T	1: 63,680,335 (GRCm39)	L408*	probably null	Het
Flg	A	G	3: 93,187,228 (GRCm39)	T227A	probably benign	Het
Heatr4	T	A	12: 84,001,784 (GRCm39)	K887M	probably null	Het
Hoxb1	C	T	11: 96,256,818 (GRCm39)	Q56*	probably null	Het
Kcnh7	T	A	2: 62,569,688 (GRCm39)	N736I	probably damaging	Het
Lgr4	T	C	2: 109,821,478 (GRCm39)	V120A	probably damaging	Het
Ltbp1	A	G	17: 75,458,397 (GRCm39)	Y326C	possibly damaging	Het
Map3k1	A	T	13: 111,892,259 (GRCm39)	S999T	probably damaging	Het
Med12l	T	C	3: 59,155,332 (GRCm39)	F1171L	probably damaging	Het
Muc5b	T	C	7: 141,412,402 (GRCm39)	S1783P	unknown	Het
Nbr1	T	C	11: 101,456,600 (GRCm39)	L159P	probably damaging	Het
Nme9	T	C	9: 99,351,760 (GRCm39)	F248S	possibly damaging	Het
Or4x11	C	T	2: 89,867,739 (GRCm39)	L159F	probably benign	Het
Or6k2	T	C	1: 173,986,830 (GRCm39)	S164P	probably damaging	Het
Setx	A	G	2: 29,020,286 (GRCm39)	D91G	probably damaging	Het
Stim1	A	G	7: 102,080,157 (GRCm39)	R514G	probably null	Het
Svep1	C	A	4: 58,049,169 (GRCm39)	G3446V	probably damaging	Het
Tcte2	T	A	17: 13,942,714 (GRCm39)		probably benign	Het
Trmt10b	A	G	4: 45,308,562 (GRCm39)	K239E	probably damaging	Het
Wdr70	A	T	15: 8,072,322 (GRCm39)	S189T	probably benign	Het

Other mutations in Rasgrf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00517:Rasgrf1	APN	9	89,852,534 (GRCm39)	missense	probably damaging	1.00
IGL00763:Rasgrf1	APN	9	89,853,073 (GRCm39)	missense	probably benign	0.05
IGL01336:Rasgrf1	APN	9	89,873,583 (GRCm39)	missense	probably benign	0.00
IGL01710:Rasgrf1	APN	9	89,873,745 (GRCm39)	missense	probably benign	0.18
IGL01807:Rasgrf1	APN	9	89,873,566 (GRCm39)	missense	probably damaging	0.99
IGL01939:Rasgrf1	APN	9	89,856,889 (GRCm39)	missense	probably damaging	0.99
IGL02453:Rasgrf1	APN	9	89,826,813 (GRCm39)	missense	possibly damaging	0.76
IGL02961:Rasgrf1	APN	9	89,863,702 (GRCm39)	missense	possibly damaging	0.88
IGL03009:Rasgrf1	APN	9	89,873,756 (GRCm39)	missense	possibly damaging	0.75
IGL03369:Rasgrf1	APN	9	89,892,504 (GRCm39)	missense	probably damaging	1.00
IGL03373:Rasgrf1	APN	9	89,899,084 (GRCm39)	splice site	probably benign
Malenkiy	UTSW	9	89,892,537 (GRCm39)	splice site	probably null
Pigeon	UTSW	9	89,849,968 (GRCm39)	missense	probably damaging	1.00
PIT4142001:Rasgrf1	UTSW	9	89,797,626 (GRCm39)	missense	possibly damaging	0.91
R0234:Rasgrf1	UTSW	9	89,891,419 (GRCm39)	missense	probably damaging	1.00
R0629:Rasgrf1	UTSW	9	89,866,322 (GRCm39)	missense	probably damaging	1.00
R0685:Rasgrf1	UTSW	9	89,797,535 (GRCm39)	utr 3 prime	probably benign
R0730:Rasgrf1	UTSW	9	89,833,062 (GRCm39)	splice site	probably benign
R0835:Rasgrf1	UTSW	9	89,882,824 (GRCm39)	missense	probably benign
R1432:Rasgrf1	UTSW	9	89,894,853 (GRCm39)	missense	probably benign	0.35
R1647:Rasgrf1	UTSW	9	89,835,973 (GRCm39)	missense	probably benign	0.28
R1717:Rasgrf1	UTSW	9	89,835,966 (GRCm39)	missense	probably damaging	0.98
R1933:Rasgrf1	UTSW	9	89,835,966 (GRCm39)	missense	probably damaging	0.98
R1934:Rasgrf1	UTSW	9	89,835,966 (GRCm39)	missense	probably damaging	0.98
R2187:Rasgrf1	UTSW	9	89,876,888 (GRCm39)	missense	possibly damaging	0.93
R2240:Rasgrf1	UTSW	9	89,858,815 (GRCm39)	missense	probably damaging	0.99
R2940:Rasgrf1	UTSW	9	89,873,767 (GRCm39)	missense	possibly damaging	0.84
R3949:Rasgrf1	UTSW	9	89,863,797 (GRCm39)	splice site	probably benign
R4751:Rasgrf1	UTSW	9	89,894,919 (GRCm39)	missense	probably damaging	1.00
R4751:Rasgrf1	UTSW	9	89,792,171 (GRCm39)	missense	probably damaging	1.00
R4901:Rasgrf1	UTSW	9	89,877,056 (GRCm39)	missense	probably benign	0.00
R4910:Rasgrf1	UTSW	9	89,858,805 (GRCm39)	missense	probably benign	0.00
R4961:Rasgrf1	UTSW	9	89,826,922 (GRCm39)	missense	probably benign	0.06
R5270:Rasgrf1	UTSW	9	89,908,747 (GRCm39)	missense	probably benign	0.00
R5320:Rasgrf1	UTSW	9	89,902,478 (GRCm39)	missense	probably damaging	0.99
R5602:Rasgrf1	UTSW	9	89,793,624 (GRCm39)	missense	possibly damaging	0.73
R5659:Rasgrf1	UTSW	9	89,866,342 (GRCm39)	missense	probably damaging	1.00
R5960:Rasgrf1	UTSW	9	89,903,437 (GRCm39)	missense	possibly damaging	0.69
R6074:Rasgrf1	UTSW	9	89,835,968 (GRCm39)	missense	probably benign	0.01
R6596:Rasgrf1	UTSW	9	89,894,847 (GRCm39)	missense	possibly damaging	0.92
R6603:Rasgrf1	UTSW	9	89,792,310 (GRCm39)	missense	probably damaging	0.96
R6647:Rasgrf1	UTSW	9	89,892,516 (GRCm39)	missense	probably benign	0.00
R6813:Rasgrf1	UTSW	9	89,892,537 (GRCm39)	splice site	probably null
R7136:Rasgrf1	UTSW	9	89,873,651 (GRCm39)	missense	probably damaging	1.00
R7155:Rasgrf1	UTSW	9	89,884,414 (GRCm39)	missense	possibly damaging	0.90
R7175:Rasgrf1	UTSW	9	89,862,802 (GRCm39)	missense	probably benign	0.02
R7202:Rasgrf1	UTSW	9	89,899,125 (GRCm39)	missense	possibly damaging	0.49
R7219:Rasgrf1	UTSW	9	89,866,341 (GRCm39)	missense	probably damaging	1.00
R7244:Rasgrf1	UTSW	9	89,876,810 (GRCm39)	missense	probably damaging	1.00
R7733:Rasgrf1	UTSW	9	89,863,780 (GRCm39)	missense	probably benign	0.01
R7764:Rasgrf1	UTSW	9	89,876,747 (GRCm39)	missense	possibly damaging	0.94
R8210:Rasgrf1	UTSW	9	89,793,675 (GRCm39)	missense	unknown
R8421:Rasgrf1	UTSW	9	89,849,968 (GRCm39)	missense	probably damaging	1.00
R8524:Rasgrf1	UTSW	9	89,797,638 (GRCm39)	missense	possibly damaging	0.53
R8526:Rasgrf1	UTSW	9	89,856,901 (GRCm39)	missense	probably damaging	0.96
R8697:Rasgrf1	UTSW	9	89,877,055 (GRCm39)	missense	probably benign
R9133:Rasgrf1	UTSW	9	89,793,600 (GRCm39)	missense	probably benign
R9153:Rasgrf1	UTSW	9	89,826,790 (GRCm39)	missense	probably damaging	1.00
R9191:Rasgrf1	UTSW	9	89,883,923 (GRCm39)	missense	probably damaging	1.00
R9349:Rasgrf1	UTSW	9	89,884,460 (GRCm39)	missense	probably damaging	0.99
R9468:Rasgrf1	UTSW	9	89,880,756 (GRCm39)	missense	probably benign	0.00
R9498:Rasgrf1	UTSW	9	89,826,921 (GRCm39)	missense	probably benign
R9747:Rasgrf1	UTSW	9	89,877,047 (GRCm39)	missense	probably benign
R9779:Rasgrf1	UTSW	9	89,873,551 (GRCm39)	missense	probably damaging	0.99
Z1177:Rasgrf1	UTSW	9	89,832,970 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGCACACATGTCACCTGTC -3'
(R):5'- TTTTCCAGAGACCTTATGGGC -3'

Sequencing Primer
(F):5'- ACACATGTCACCTGTCCTTGC -3'
(R):5'- CCAGGCATTGGGATTAGTTCATCAG -3'

Posted On

2018-05-04