Incidental Mutation 'R6400:Hoxb1'
ID516135
Institutional Source Beutler Lab
Gene Symbol Hoxb1
Ensembl Gene ENSMUSG00000018973
Gene Namehomeobox B1
SynonymsHox-2.9
MMRRC Submission
Accession Numbers

Genbank: NM_008266; MGI: 96182

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6400 (G1)
Quality Score194.009
Status Validated
Chromosome11
Chromosomal Location96365752-96368256 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 96365992 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 56 (Q56*)
Ref Sequence ENSEMBL: ENSMUSP00000019117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019117]
Predicted Effect probably null
Transcript: ENSMUST00000019117
AA Change: Q56*
SMART Domains Protein: ENSMUSP00000019117
Gene: ENSMUSG00000018973
AA Change: Q56*

DomainStartEndE-ValueType
low complexity region 72 85 N/A INTRINSIC
low complexity region 124 142 N/A INTRINSIC
HOX 199 261 6.97e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123805
Meta Mutation Damage Score 0.9714 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.2%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXB genes located in a cluster on chromosome 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele die neonatally with altered segmental identity and abnormal migration of motor neurons in the hindbrain. Mice homozygous for null alleles can exhibit partial postnatal lethality, narrow face, runting, absent facial motor nuclei, and facial nerve/muscle defects. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(2) Targeted, other(10)

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,692,709 *160Q probably null Het
Aen G A 7: 78,907,394 G330E probably benign Het
Akap8l G A 17: 32,336,320 R262C probably damaging Het
Cbx8 G A 11: 119,038,868 Q300* probably null Het
Cd274 C T 19: 29,385,408 T290M probably damaging Het
Cd36 A C 5: 17,814,723 S127A probably damaging Het
Celf3 A G 3: 94,480,286 Y55C probably damaging Het
Clec1a A T 6: 129,435,353 probably null Het
Cog2 A T 8: 124,550,306 I684F probably damaging Het
Cyp2c65 C T 19: 39,061,114 L29F possibly damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Dytn A T 1: 63,641,176 L408* probably null Het
Flg A G 3: 93,279,921 T227A probably benign Het
Heatr4 T A 12: 83,955,010 K887M probably null Het
Kcnh7 T A 2: 62,739,344 N736I probably damaging Het
Lgr4 T C 2: 109,991,133 V120A probably damaging Het
Ltbp1 A G 17: 75,151,402 Y326C possibly damaging Het
Map3k1 A T 13: 111,755,725 S999T probably damaging Het
Med12l T C 3: 59,247,911 F1171L probably damaging Het
Muc5b T C 7: 141,858,665 S1783P unknown Het
Nbr1 T C 11: 101,565,774 L159P probably damaging Het
Nme9 T C 9: 99,469,707 F248S possibly damaging Het
Olfr1265 C T 2: 90,037,395 L159F probably benign Het
Olfr420 T C 1: 174,159,264 S164P probably damaging Het
Rasgrf1 C T 9: 89,991,630 T664I probably damaging Het
Setx A G 2: 29,130,274 D91G probably damaging Het
Stim1 A G 7: 102,430,950 R514G probably null Het
Svep1 C A 4: 58,049,169 G3446V probably damaging Het
Tcte2 T A 17: 13,722,452 probably benign Het
Trmt10b A G 4: 45,308,562 K239E probably damaging Het
Wdr70 A T 15: 8,042,841 S189T probably benign Het
Other mutations in Hoxb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
F6893:Hoxb1 UTSW 11 96365902 missense probably benign 0.04
R1921:Hoxb1 UTSW 11 96366112 missense probably damaging 0.99
R2352:Hoxb1 UTSW 11 96366377 missense possibly damaging 0.81
R2921:Hoxb1 UTSW 11 96366293 missense probably benign 0.30
R2922:Hoxb1 UTSW 11 96366293 missense probably benign 0.30
R2923:Hoxb1 UTSW 11 96366293 missense probably benign 0.30
R5530:Hoxb1 UTSW 11 96366928 missense probably damaging 1.00
R5715:Hoxb1 UTSW 11 96366326 missense probably benign 0.00
R6720:Hoxb1 UTSW 11 96366987 missense probably damaging 1.00
R7311:Hoxb1 UTSW 11 96367101 missense possibly damaging 0.47
Z1176:Hoxb1 UTSW 11 96367051 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCTCTGTGACATACTGCCGAAAG -3'
(R):5'- TCGACGGATGAAAATAGCTTCC -3'

Sequencing Primer
(F):5'- TAGGGCAAGAGGGTGTCTCC -3'
(R):5'- GACGGATGAAAATAGCTTCCATCTC -3'
Posted On2018-05-04