Incidental Mutation 'R6400:Cbx8'
ID516137
Institutional Source Beutler Lab
Gene Symbol Cbx8
Ensembl Gene ENSMUSG00000025578
Gene Namechromobox 8
SynonymsPc3, polycomb 3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6400 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location119036305-119040969 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 119038868 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 300 (Q300*)
Ref Sequence ENSEMBL: ENSMUSP00000026663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026663]
PDB Structure
Solution Structure of RSGI RUH-055, a Chromo Domain from Mus musculus cDNA [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000026663
AA Change: Q300*
SMART Domains Protein: ENSMUSP00000026663
Gene: ENSMUSG00000025578
AA Change: Q300*

DomainStartEndE-ValueType
CHROMO 10 62 2.91e-18 SMART
low complexity region 82 90 N/A INTRINSIC
low complexity region 140 153 N/A INTRINSIC
low complexity region 159 176 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143831
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.2%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired MLL-AF9 transformation but are otherwise viable with normal hematopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,692,709 *160Q probably null Het
Aen G A 7: 78,907,394 G330E probably benign Het
Akap8l G A 17: 32,336,320 R262C probably damaging Het
Cd274 C T 19: 29,385,408 T290M probably damaging Het
Cd36 A C 5: 17,814,723 S127A probably damaging Het
Celf3 A G 3: 94,480,286 Y55C probably damaging Het
Clec1a A T 6: 129,435,353 probably null Het
Cog2 A T 8: 124,550,306 I684F probably damaging Het
Cyp2c65 C T 19: 39,061,114 L29F possibly damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Dytn A T 1: 63,641,176 L408* probably null Het
Flg A G 3: 93,279,921 T227A probably benign Het
Heatr4 T A 12: 83,955,010 K887M probably null Het
Hoxb1 C T 11: 96,365,992 Q56* probably null Het
Kcnh7 T A 2: 62,739,344 N736I probably damaging Het
Lgr4 T C 2: 109,991,133 V120A probably damaging Het
Ltbp1 A G 17: 75,151,402 Y326C possibly damaging Het
Map3k1 A T 13: 111,755,725 S999T probably damaging Het
Med12l T C 3: 59,247,911 F1171L probably damaging Het
Muc5b T C 7: 141,858,665 S1783P unknown Het
Nbr1 T C 11: 101,565,774 L159P probably damaging Het
Nme9 T C 9: 99,469,707 F248S possibly damaging Het
Olfr1265 C T 2: 90,037,395 L159F probably benign Het
Olfr420 T C 1: 174,159,264 S164P probably damaging Het
Rasgrf1 C T 9: 89,991,630 T664I probably damaging Het
Setx A G 2: 29,130,274 D91G probably damaging Het
Stim1 A G 7: 102,430,950 R514G probably null Het
Svep1 C A 4: 58,049,169 G3446V probably damaging Het
Tcte2 T A 17: 13,722,452 probably benign Het
Trmt10b A G 4: 45,308,562 K239E probably damaging Het
Wdr70 A T 15: 8,042,841 S189T probably benign Het
Other mutations in Cbx8
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1213:Cbx8 UTSW 11 119039533 splice site probably null
R1299:Cbx8 UTSW 11 119040850 start codon destroyed probably null 0.99
R4497:Cbx8 UTSW 11 119040792 missense probably damaging 1.00
R5282:Cbx8 UTSW 11 119038916 missense probably damaging 0.98
R5695:Cbx8 UTSW 11 119039311 missense probably benign
R6237:Cbx8 UTSW 11 119040387 missense possibly damaging 0.95
R6980:Cbx8 UTSW 11 119039461 missense possibly damaging 0.73
R7697:Cbx8 UTSW 11 119040811 nonsense probably null
R8428:Cbx8 UTSW 11 119038928 missense probably damaging 0.97
Z1176:Cbx8 UTSW 11 119039119 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AATCCTTGGTCCGTGTTGC -3'
(R):5'- TGATCCAGCTTGCTCGAAGG -3'

Sequencing Primer
(F):5'- GCTCTCCTTAATGGTGACGGTC -3'
(R):5'- CTCAGACCTGGTGCAATATGG -3'
Posted On2018-05-04