Incidental Mutation 'R6400:Wdr70'
ID516140
Institutional Source Beutler Lab
Gene Symbol Wdr70
Ensembl Gene ENSMUSG00000039828
Gene NameWD repeat domain 70
Synonyms4833422F06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R6400 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location7873055-8099209 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8042841 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 189 (S189T)
Ref Sequence ENSEMBL: ENSMUSP00000037340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045766]
Predicted Effect probably benign
Transcript: ENSMUST00000045766
AA Change: S189T

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000037340
Gene: ENSMUSG00000039828
AA Change: S189T

DomainStartEndE-ValueType
coiled coil region 51 81 N/A INTRINSIC
low complexity region 137 167 N/A INTRINSIC
WD40 174 213 1.61e-3 SMART
WD40 220 260 3.2e0 SMART
WD40 272 315 1.03e0 SMART
WD40 324 363 1.7e-2 SMART
WD40 367 409 1.38e-2 SMART
Blast:WD40 413 460 5e-16 BLAST
WD40 463 502 3.44e0 SMART
low complexity region 570 586 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.2%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,692,709 *160Q probably null Het
Aen G A 7: 78,907,394 G330E probably benign Het
Akap8l G A 17: 32,336,320 R262C probably damaging Het
Cbx8 G A 11: 119,038,868 Q300* probably null Het
Cd274 C T 19: 29,385,408 T290M probably damaging Het
Cd36 A C 5: 17,814,723 S127A probably damaging Het
Celf3 A G 3: 94,480,286 Y55C probably damaging Het
Clec1a A T 6: 129,435,353 probably null Het
Cog2 A T 8: 124,550,306 I684F probably damaging Het
Cyp2c65 C T 19: 39,061,114 L29F possibly damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Dytn A T 1: 63,641,176 L408* probably null Het
Flg A G 3: 93,279,921 T227A probably benign Het
Heatr4 T A 12: 83,955,010 K887M probably null Het
Hoxb1 C T 11: 96,365,992 Q56* probably null Het
Kcnh7 T A 2: 62,739,344 N736I probably damaging Het
Lgr4 T C 2: 109,991,133 V120A probably damaging Het
Ltbp1 A G 17: 75,151,402 Y326C possibly damaging Het
Map3k1 A T 13: 111,755,725 S999T probably damaging Het
Med12l T C 3: 59,247,911 F1171L probably damaging Het
Muc5b T C 7: 141,858,665 S1783P unknown Het
Nbr1 T C 11: 101,565,774 L159P probably damaging Het
Nme9 T C 9: 99,469,707 F248S possibly damaging Het
Olfr1265 C T 2: 90,037,395 L159F probably benign Het
Olfr420 T C 1: 174,159,264 S164P probably damaging Het
Rasgrf1 C T 9: 89,991,630 T664I probably damaging Het
Setx A G 2: 29,130,274 D91G probably damaging Het
Stim1 A G 7: 102,430,950 R514G probably null Het
Svep1 C A 4: 58,049,169 G3446V probably damaging Het
Tcte2 T A 17: 13,722,452 probably benign Het
Trmt10b A G 4: 45,308,562 K239E probably damaging Het
Other mutations in Wdr70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Wdr70 APN 15 8019607 missense probably benign 0.07
IGL01121:Wdr70 APN 15 7873174 missense possibly damaging 0.53
IGL01508:Wdr70 APN 15 8079263 missense probably benign 0.33
IGL01801:Wdr70 APN 15 7887324 splice site probably null
IGL01815:Wdr70 APN 15 7887324 splice site probably null
IGL01929:Wdr70 APN 15 7920634 splice site probably null
IGL02150:Wdr70 APN 15 8082546 missense possibly damaging 0.72
IGL02245:Wdr70 APN 15 8046482 missense possibly damaging 0.86
IGL02541:Wdr70 APN 15 7884302 nonsense probably null
IGL02800:Wdr70 APN 15 8082496 missense probably benign 0.25
IGL02829:Wdr70 APN 15 7976982 missense possibly damaging 0.92
IGL02831:Wdr70 APN 15 7884306 missense possibly damaging 0.86
IGL03169:Wdr70 APN 15 7884340 missense possibly damaging 0.73
IGL03405:Wdr70 APN 15 8035871 missense possibly damaging 0.73
R0106:Wdr70 UTSW 15 8019587 critical splice donor site probably null
R0106:Wdr70 UTSW 15 8019587 critical splice donor site probably null
R0462:Wdr70 UTSW 15 8079161 missense probably benign 0.00
R0539:Wdr70 UTSW 15 7885637 missense possibly damaging 0.96
R1398:Wdr70 UTSW 15 8035844 missense probably benign 0.01
R1812:Wdr70 UTSW 15 8079179 missense probably benign 0.00
R1863:Wdr70 UTSW 15 7920573 missense probably benign 0.25
R1913:Wdr70 UTSW 15 7884410 missense possibly damaging 0.72
R2425:Wdr70 UTSW 15 7887359 nonsense probably null
R4013:Wdr70 UTSW 15 8079214 nonsense probably null
R4015:Wdr70 UTSW 15 8079214 nonsense probably null
R4017:Wdr70 UTSW 15 8079214 nonsense probably null
R4111:Wdr70 UTSW 15 7976991 missense probably benign 0.32
R5241:Wdr70 UTSW 15 8079216 missense probably benign
R5277:Wdr70 UTSW 15 7976984 nonsense probably null
R5306:Wdr70 UTSW 15 7924273 missense probably benign 0.04
R5426:Wdr70 UTSW 15 7922105 missense possibly damaging 0.59
R5586:Wdr70 UTSW 15 7884288 missense possibly damaging 0.86
R6010:Wdr70 UTSW 15 7887419 splice site probably null
R6035:Wdr70 UTSW 15 7887349 missense possibly damaging 0.86
R6035:Wdr70 UTSW 15 7887349 missense possibly damaging 0.86
R6109:Wdr70 UTSW 15 8079154 splice site probably null
R6139:Wdr70 UTSW 15 8079251 missense probably benign 0.04
R6456:Wdr70 UTSW 15 7885637 missense possibly damaging 0.96
R6518:Wdr70 UTSW 15 8079337 missense unknown
R7036:Wdr70 UTSW 15 7884374 missense possibly damaging 0.85
R7056:Wdr70 UTSW 15 7884396 missense possibly damaging 0.53
R7341:Wdr70 UTSW 15 7924244 missense possibly damaging 0.71
R7484:Wdr70 UTSW 15 7922081 missense probably benign 0.23
R7572:Wdr70 UTSW 15 8035846 missense possibly damaging 0.85
R7652:Wdr70 UTSW 15 8079216 missense probably benign
R7886:Wdr70 UTSW 15 8079249 missense probably benign 0.02
R8103:Wdr70 UTSW 15 7977131 missense possibly damaging 0.70
R8214:Wdr70 UTSW 15 7887370 missense probably benign 0.03
R8252:Wdr70 UTSW 15 8042856 splice site probably benign
Predicted Primers PCR Primer
(F):5'- GCCAAAAGCTAACCATGGAG -3'
(R):5'- TGGTTCACATGTGCAGGTGTAC -3'

Sequencing Primer
(F):5'- AGCTAACCATGGAGCTGTTAAG -3'
(R):5'- TTACTAAGCTGGAGCCCATTG -3'
Posted On2018-05-04