Incidental Mutation 'R6400:Cd274'
ID516144
Institutional Source Beutler Lab
Gene Symbol Cd274
Ensembl Gene ENSMUSG00000016496
Gene NameCD274 antigen
SynonymsPdcd1lg1, B7-H1, PD-L1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6400 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location29367455-29388095 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 29385408 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 290 (T290M)
Ref Sequence ENSEMBL: ENSMUSP00000016640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016640]
Predicted Effect probably damaging
Transcript: ENSMUST00000016640
AA Change: T290M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016640
Gene: ENSMUSG00000016496
AA Change: T290M

DomainStartEndE-ValueType
IG 24 131 1.5e-7 SMART
IG_like 138 226 4.78e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.2%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: The protein encoded by this gene is an immune inhibitory receptor ligand that is expressed by hematopoietic and non-hematopoietic cells, such as T cells and B cells and various types of tumor cells. The encoded protein is a type I transmembrane protein that has immunoglobulin V-like and C-like domains. Interaction of this ligand with its receptor inhibits T-cell activation and cytokine production. During infection or inflammation of normal tissue, this interaction is important for preventing autoimmunity by maintaining homeostasis of the immune response. In tumor microenvironments, this interaction provides an immune escape for tumor cells through cytotoxic T-cell inactivation. Mice deficient for this gene display a variety of phenotypes including decreased allogeneic fetal survival rates and severe experimental autoimmune encephalomyelitis. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered susceptibility to experimental autoimmune encephalomyelitis, induced arthritis, nerve injury, autoimmune diabetes, bacterial infection, viral infection, and parasitic infection due to abnormal T cellmorphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,692,709 *160Q probably null Het
Aen G A 7: 78,907,394 G330E probably benign Het
Akap8l G A 17: 32,336,320 R262C probably damaging Het
Cbx8 G A 11: 119,038,868 Q300* probably null Het
Cd36 A C 5: 17,814,723 S127A probably damaging Het
Celf3 A G 3: 94,480,286 Y55C probably damaging Het
Clec1a A T 6: 129,435,353 probably null Het
Cog2 A T 8: 124,550,306 I684F probably damaging Het
Cyp2c65 C T 19: 39,061,114 L29F possibly damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Dytn A T 1: 63,641,176 L408* probably null Het
Flg A G 3: 93,279,921 T227A probably benign Het
Heatr4 T A 12: 83,955,010 K887M probably null Het
Hoxb1 C T 11: 96,365,992 Q56* probably null Het
Kcnh7 T A 2: 62,739,344 N736I probably damaging Het
Lgr4 T C 2: 109,991,133 V120A probably damaging Het
Ltbp1 A G 17: 75,151,402 Y326C possibly damaging Het
Map3k1 A T 13: 111,755,725 S999T probably damaging Het
Med12l T C 3: 59,247,911 F1171L probably damaging Het
Muc5b T C 7: 141,858,665 S1783P unknown Het
Nbr1 T C 11: 101,565,774 L159P probably damaging Het
Nme9 T C 9: 99,469,707 F248S possibly damaging Het
Olfr1265 C T 2: 90,037,395 L159F probably benign Het
Olfr420 T C 1: 174,159,264 S164P probably damaging Het
Rasgrf1 C T 9: 89,991,630 T664I probably damaging Het
Setx A G 2: 29,130,274 D91G probably damaging Het
Stim1 A G 7: 102,430,950 R514G probably null Het
Svep1 C A 4: 58,049,169 G3446V probably damaging Het
Tcte2 T A 17: 13,722,452 probably benign Het
Trmt10b A G 4: 45,308,562 K239E probably damaging Het
Wdr70 A T 15: 8,042,841 S189T probably benign Het
Other mutations in Cd274
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01766:Cd274 APN 19 29385410 makesense probably null
IGL02232:Cd274 APN 19 29382538 missense probably damaging 0.99
IGL03304:Cd274 APN 19 29384102 missense probably damaging 0.99
R1233:Cd274 UTSW 19 29373901 critical splice donor site probably null
R1356:Cd274 UTSW 19 29373570 missense possibly damaging 0.92
R1464:Cd274 UTSW 19 29382592 splice site probably benign
R1853:Cd274 UTSW 19 29380482 missense probably damaging 1.00
R4280:Cd274 UTSW 19 29380471 missense probably benign
R4283:Cd274 UTSW 19 29380471 missense probably benign
R4553:Cd274 UTSW 19 29380448 missense probably benign 0.43
R5063:Cd274 UTSW 19 29384143 missense probably damaging 0.99
R5122:Cd274 UTSW 19 29380565 missense possibly damaging 0.57
R5187:Cd274 UTSW 19 29382536 missense probably benign 0.01
R5736:Cd274 UTSW 19 29382540 missense probably benign 0.02
R8114:Cd274 UTSW 19 29384128 missense probably damaging 1.00
R8247:Cd274 UTSW 19 29385395 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGTAGTCAGACATAGGTAGTATCTG -3'
(R):5'- AAAGGTCACTGTGCAAGGAC -3'

Sequencing Primer
(F):5'- CAGACATAGGTAGTATCTGTCTCTG -3'
(R):5'- TTTCCCAAGACGACTGATGG -3'
Posted On2018-05-04