Incidental Mutation 'R6400:Cyp2c65'
ID516145
Institutional Source Beutler Lab
Gene Symbol Cyp2c65
Ensembl Gene ENSMUSG00000067231
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 65
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R6400 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location39061015-39093944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 39061114 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 29 (L29F)
Ref Sequence ENSEMBL: ENSMUSP00000084489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087236]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087236
AA Change: L29F

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000084489
Gene: ENSMUSG00000067231
AA Change: L29F

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 2.1e-160 PFAM
Meta Mutation Damage Score 0.1480 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.2%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,692,709 *160Q probably null Het
Aen G A 7: 78,907,394 G330E probably benign Het
Akap8l G A 17: 32,336,320 R262C probably damaging Het
Cbx8 G A 11: 119,038,868 Q300* probably null Het
Cd274 C T 19: 29,385,408 T290M probably damaging Het
Cd36 A C 5: 17,814,723 S127A probably damaging Het
Celf3 A G 3: 94,480,286 Y55C probably damaging Het
Clec1a A T 6: 129,435,353 probably null Het
Cog2 A T 8: 124,550,306 I684F probably damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Dytn A T 1: 63,641,176 L408* probably null Het
Flg A G 3: 93,279,921 T227A probably benign Het
Heatr4 T A 12: 83,955,010 K887M probably null Het
Hoxb1 C T 11: 96,365,992 Q56* probably null Het
Kcnh7 T A 2: 62,739,344 N736I probably damaging Het
Lgr4 T C 2: 109,991,133 V120A probably damaging Het
Ltbp1 A G 17: 75,151,402 Y326C possibly damaging Het
Map3k1 A T 13: 111,755,725 S999T probably damaging Het
Med12l T C 3: 59,247,911 F1171L probably damaging Het
Muc5b T C 7: 141,858,665 S1783P unknown Het
Nbr1 T C 11: 101,565,774 L159P probably damaging Het
Nme9 T C 9: 99,469,707 F248S possibly damaging Het
Olfr1265 C T 2: 90,037,395 L159F probably benign Het
Olfr420 T C 1: 174,159,264 S164P probably damaging Het
Rasgrf1 C T 9: 89,991,630 T664I probably damaging Het
Setx A G 2: 29,130,274 D91G probably damaging Het
Stim1 A G 7: 102,430,950 R514G probably null Het
Svep1 C A 4: 58,049,169 G3446V probably damaging Het
Tcte2 T A 17: 13,722,452 probably benign Het
Trmt10b A G 4: 45,308,562 K239E probably damaging Het
Wdr70 A T 15: 8,042,841 S189T probably benign Het
Other mutations in Cyp2c65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Cyp2c65 APN 19 39072177 critical splice acceptor site probably null
IGL01124:Cyp2c65 APN 19 39093510 utr 3 prime probably benign
IGL01895:Cyp2c65 APN 19 39072232 missense possibly damaging 0.90
IGL02544:Cyp2c65 APN 19 39090638 missense probably damaging 1.00
R0172:Cyp2c65 UTSW 19 39087656 missense possibly damaging 0.86
R0378:Cyp2c65 UTSW 19 39073218 missense probably benign 0.19
R0517:Cyp2c65 UTSW 19 39082348 splice site probably benign
R0585:Cyp2c65 UTSW 19 39069242 missense probably benign 0.00
R1770:Cyp2c65 UTSW 19 39082198 missense probably benign 0.07
R2051:Cyp2c65 UTSW 19 39082231 missense probably benign 0.12
R2310:Cyp2c65 UTSW 19 39093382 missense probably benign 0.02
R2911:Cyp2c65 UTSW 19 39087682 missense probably damaging 0.96
R4208:Cyp2c65 UTSW 19 39090655 missense probably damaging 1.00
R4258:Cyp2c65 UTSW 19 39093428 missense probably benign 0.41
R4734:Cyp2c65 UTSW 19 39072334 missense probably benign 0.00
R4821:Cyp2c65 UTSW 19 39072191 missense probably damaging 1.00
R4926:Cyp2c65 UTSW 19 39061153 missense probably benign 0.00
R5060:Cyp2c65 UTSW 19 39061070 missense unknown
R5091:Cyp2c65 UTSW 19 39087565 critical splice acceptor site probably null
R5433:Cyp2c65 UTSW 19 39093484 missense probably benign 0.00
R6051:Cyp2c65 UTSW 19 39061166 missense probably benign 0.29
R6182:Cyp2c65 UTSW 19 39061162 missense probably benign 0.18
R6586:Cyp2c65 UTSW 19 39082218 missense possibly damaging 0.89
R6672:Cyp2c65 UTSW 19 39087674 missense probably damaging 1.00
R6850:Cyp2c65 UTSW 19 39069091 missense probably benign 0.15
R8075:Cyp2c65 UTSW 19 39072238 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TCAGAGAATCACGGATGTATTAGC -3'
(R):5'- AAGTAGCCCATCAAGCTTAGG -3'

Sequencing Primer
(F):5'- ATCACGGATGTATTAGCAGTTGTCC -3'
(R):5'- TCTATTGTATAGAGCAGGCCCAGC -3'
Posted On2018-05-04