Incidental Mutation 'R6401:Rgs12'
ID516157
Institutional Source Beutler Lab
Gene Symbol Rgs12
Ensembl Gene ENSMUSG00000029101
Gene Nameregulator of G-protein signaling 12
Synonyms1200016K18Rik, 4632412M04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R6401 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location34949445-35039644 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35020332 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 79 (F79L)
Ref Sequence ENSEMBL: ENSMUSP00000109920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030984] [ENSMUST00000087684] [ENSMUST00000114280] [ENSMUST00000114281] [ENSMUST00000114283] [ENSMUST00000114284] [ENSMUST00000114285] [ENSMUST00000156339] [ENSMUST00000225237]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030984
AA Change: F737L

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000030984
Gene: ENSMUSG00000029101
AA Change: F737L

DomainStartEndE-ValueType
PDZ 29 98 5.25e-18 SMART
PTB 224 373 5.05e-28 SMART
low complexity region 443 456 N/A INTRINSIC
low complexity region 643 661 N/A INTRINSIC
low complexity region 685 697 N/A INTRINSIC
RGS 715 832 2.84e-41 SMART
low complexity region 849 865 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
low complexity region 911 928 N/A INTRINSIC
RBD 962 1032 3.12e-28 SMART
RBD 1034 1104 2.44e-21 SMART
GoLoco 1187 1209 9.74e-9 SMART
low complexity region 1259 1280 N/A INTRINSIC
low complexity region 1292 1308 N/A INTRINSIC
low complexity region 1359 1378 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087684
AA Change: F737L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084970
Gene: ENSMUSG00000029101
AA Change: F737L

DomainStartEndE-ValueType
PDZ 29 98 5.25e-18 SMART
PTB 224 373 5.05e-28 SMART
low complexity region 443 456 N/A INTRINSIC
low complexity region 643 661 N/A INTRINSIC
low complexity region 685 697 N/A INTRINSIC
RGS 715 832 2.84e-41 SMART
Pfam:RGS12_us1 836 953 4.3e-61 PFAM
RBD 962 1032 3.12e-28 SMART
RBD 1034 1104 2.44e-21 SMART
Pfam:RGS12_us2 1106 1180 2.4e-37 PFAM
GoLoco 1187 1209 9.74e-9 SMART
Pfam:RGS12_usC 1238 1379 9.2e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114280
AA Change: F79L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109919
Gene: ENSMUSG00000029101
AA Change: F79L

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
RGS 57 174 2.84e-41 SMART
low complexity region 191 207 N/A INTRINSIC
low complexity region 210 222 N/A INTRINSIC
low complexity region 253 270 N/A INTRINSIC
RBD 304 374 3.12e-28 SMART
RBD 376 446 2.44e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114281
AA Change: F79L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109920
Gene: ENSMUSG00000029101
AA Change: F79L

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
RGS 57 174 2.84e-41 SMART
low complexity region 191 207 N/A INTRINSIC
low complexity region 210 222 N/A INTRINSIC
low complexity region 253 270 N/A INTRINSIC
RBD 304 374 3.12e-28 SMART
RBD 376 446 2.44e-21 SMART
GoLoco 529 551 9.74e-9 SMART
low complexity region 601 622 N/A INTRINSIC
low complexity region 634 650 N/A INTRINSIC
low complexity region 701 720 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114283
AA Change: F79L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109922
Gene: ENSMUSG00000029101
AA Change: F79L

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
RGS 57 174 2.84e-41 SMART
low complexity region 191 207 N/A INTRINSIC
low complexity region 210 222 N/A INTRINSIC
low complexity region 253 270 N/A INTRINSIC
RBD 304 374 3.12e-28 SMART
RBD 376 446 2.44e-21 SMART
GoLoco 529 551 9.74e-9 SMART
low complexity region 601 622 N/A INTRINSIC
low complexity region 634 650 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114284
AA Change: F89L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109923
Gene: ENSMUSG00000029101
AA Change: F89L

DomainStartEndE-ValueType
low complexity region 37 49 N/A INTRINSIC
RGS 67 184 2.84e-41 SMART
low complexity region 201 217 N/A INTRINSIC
low complexity region 220 232 N/A INTRINSIC
low complexity region 263 280 N/A INTRINSIC
RBD 314 384 3.12e-28 SMART
RBD 386 456 2.44e-21 SMART
GoLoco 539 561 9.74e-9 SMART
low complexity region 611 632 N/A INTRINSIC
low complexity region 644 660 N/A INTRINSIC
low complexity region 711 730 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114285
AA Change: F89L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109924
Gene: ENSMUSG00000029101
AA Change: F89L

DomainStartEndE-ValueType
low complexity region 37 49 N/A INTRINSIC
RGS 67 184 2.84e-41 SMART
low complexity region 201 217 N/A INTRINSIC
low complexity region 220 232 N/A INTRINSIC
low complexity region 263 280 N/A INTRINSIC
RBD 314 384 3.12e-28 SMART
RBD 386 456 2.44e-21 SMART
GoLoco 539 561 9.74e-9 SMART
low complexity region 611 632 N/A INTRINSIC
low complexity region 644 660 N/A INTRINSIC
low complexity region 707 739 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141562
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153972
Predicted Effect probably benign
Transcript: ENSMUST00000156339
SMART Domains Protein: ENSMUSP00000115064
Gene: ENSMUSG00000029101

DomainStartEndE-ValueType
Pfam:RGS 1 30 1.3e-7 PFAM
low complexity region 48 64 N/A INTRINSIC
low complexity region 67 79 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156819
SMART Domains Protein: ENSMUSP00000116913
Gene: ENSMUSG00000029101

DomainStartEndE-ValueType
RBD 21 91 3.12e-28 SMART
RBD 93 163 2.44e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175356
Predicted Effect probably benign
Transcript: ENSMUST00000201936
Predicted Effect probably benign
Transcript: ENSMUST00000225237
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 93% (41/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 'regulator of G protein signaling' (RGS) gene family. The encoded protein may function as a guanosine triphosphatase (GTPase)-activating protein as well as a transcriptional repressor. This protein may play a role in tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene. Other alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano3 T A 2: 110,775,114 N249I probably benign Het
Ap3s1 A C 18: 46,758,007 I56L probably benign Het
Cngb1 A G 8: 95,303,739 probably benign Het
Col2a1 T C 15: 97,985,892 T570A unknown Het
Cyp3a16 T C 5: 145,440,364 E471G probably damaging Het
D930020B18Rik A G 10: 121,641,857 N14D possibly damaging Het
Ext1 T C 15: 53,106,097 E365G possibly damaging Het
Fbn1 C A 2: 125,346,450 V1490F probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm4869 A T 5: 140,456,943 T80S possibly damaging Het
Gm5431 T A 11: 48,888,709 N740I probably benign Het
Ifi209 T C 1: 173,644,703 M370T probably damaging Het
Ighv2-4 G T 12: 113,653,462 P60Q probably damaging Het
Ldb3 A T 14: 34,577,334 L111Q probably benign Het
Mcmbp G T 7: 128,707,059 L413I possibly damaging Het
Mib1 T A 18: 10,795,802 M721K probably benign Het
Nos3 A G 5: 24,379,811 T738A probably benign Het
Notch3 T A 17: 32,158,623 I160L probably benign Het
Nrxn3 C A 12: 89,255,000 N516K possibly damaging Het
Nt5c2 A G 19: 46,889,811 Y496H probably benign Het
Olfr1465 T C 19: 13,313,514 Y257C probably damaging Het
Olfr275 A C 4: 52,826,242 T282P probably damaging Het
Olfr351 A T 2: 36,860,165 L61* probably null Het
Polm A T 11: 5,829,491 W436R probably damaging Het
Prex2 T A 1: 11,186,727 I1221N probably benign Het
Rfpl4b T C 10: 38,820,945 H220R possibly damaging Het
Rxfp2 A G 5: 150,043,130 D111G probably benign Het
Smg7 A G 1: 152,840,136 probably null Het
Spata22 T C 11: 73,333,354 S34P probably damaging Het
St7 T A 6: 17,855,318 probably null Het
Stk31 A G 6: 49,423,438 E399G probably damaging Het
Tcp10b C A 17: 13,073,579 N296K probably damaging Het
Tonsl T C 15: 76,633,666 Y645C probably damaging Het
Ttn A T 2: 76,969,862 M334K probably benign Het
Vcpkmt C A 12: 69,582,845 V48F probably damaging Het
Vmn2r112 T A 17: 22,603,551 Y403* probably null Het
Vwa7 G A 17: 35,017,310 probably null Het
Wisp2 T C 2: 163,829,026 I151T probably benign Het
Wscd2 A T 5: 113,588,145 *572C probably null Het
Xpo7 A G 14: 70,682,347 L676P probably damaging Het
Zbtb32 A C 7: 30,591,819 L17W probably damaging Het
Other mutations in Rgs12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Rgs12 APN 5 34975219 missense probably benign 0.25
IGL02296:Rgs12 APN 5 34966120 missense probably damaging 0.96
IGL02337:Rgs12 APN 5 35020353 missense probably damaging 1.00
IGL02483:Rgs12 APN 5 35030517 missense probably damaging 1.00
IGL02869:Rgs12 APN 5 35025883 missense probably damaging 0.97
IGL02989:Rgs12 APN 5 34965119 missense probably damaging 1.00
R0015:Rgs12 UTSW 5 35022776 unclassified probably benign
R0015:Rgs12 UTSW 5 35022776 unclassified probably benign
R0046:Rgs12 UTSW 5 34965320 missense probably damaging 1.00
R0046:Rgs12 UTSW 5 34965320 missense probably damaging 1.00
R0106:Rgs12 UTSW 5 34966664 missense probably benign 0.03
R0106:Rgs12 UTSW 5 34966664 missense probably benign 0.03
R0233:Rgs12 UTSW 5 35030498 missense probably damaging 1.00
R0233:Rgs12 UTSW 5 35030498 missense probably damaging 1.00
R0245:Rgs12 UTSW 5 35030080 missense probably benign 0.01
R0611:Rgs12 UTSW 5 35019460 missense probably damaging 1.00
R0704:Rgs12 UTSW 5 35023122 missense possibly damaging 0.95
R0723:Rgs12 UTSW 5 35024366 unclassified probably benign
R1174:Rgs12 UTSW 5 34966465 missense probably benign 0.00
R1538:Rgs12 UTSW 5 35021167 missense probably damaging 0.98
R1556:Rgs12 UTSW 5 35039282 missense possibly damaging 0.67
R1774:Rgs12 UTSW 5 34966403 missense probably benign 0.34
R1791:Rgs12 UTSW 5 34966112 missense possibly damaging 0.86
R1866:Rgs12 UTSW 5 34965674 missense probably damaging 1.00
R1872:Rgs12 UTSW 5 34965821 missense probably damaging 1.00
R1923:Rgs12 UTSW 5 35032269 missense probably damaging 1.00
R2012:Rgs12 UTSW 5 35030528 missense probably benign 0.00
R2107:Rgs12 UTSW 5 34966735 missense possibly damaging 0.68
R3730:Rgs12 UTSW 5 35032251 missense probably damaging 1.00
R3731:Rgs12 UTSW 5 35032251 missense probably damaging 1.00
R3808:Rgs12 UTSW 5 35032354 missense probably damaging 1.00
R3826:Rgs12 UTSW 5 34966015 missense possibly damaging 0.94
R3827:Rgs12 UTSW 5 34966015 missense possibly damaging 0.94
R3829:Rgs12 UTSW 5 34966015 missense possibly damaging 0.94
R3830:Rgs12 UTSW 5 34966015 missense possibly damaging 0.94
R4392:Rgs12 UTSW 5 35032311 missense probably damaging 1.00
R4617:Rgs12 UTSW 5 35020356 missense probably damaging 1.00
R5132:Rgs12 UTSW 5 34989812 intron probably benign
R5213:Rgs12 UTSW 5 34965320 missense probably damaging 1.00
R5296:Rgs12 UTSW 5 35021104 unclassified probably benign
R5480:Rgs12 UTSW 5 34966111 missense probably benign 0.09
R5510:Rgs12 UTSW 5 34966039 missense probably damaging 1.00
R5708:Rgs12 UTSW 5 34966352 missense probably benign 0.41
R5987:Rgs12 UTSW 5 35020345 missense probably damaging 1.00
R6053:Rgs12 UTSW 5 34965952 missense probably benign 0.01
R6113:Rgs12 UTSW 5 35020323 missense probably damaging 0.99
R6736:Rgs12 UTSW 5 35023092 missense probably damaging 1.00
R6807:Rgs12 UTSW 5 35023171 missense probably null 0.27
R6857:Rgs12 UTSW 5 35030022 nonsense probably null
R7082:Rgs12 UTSW 5 34966706 missense probably benign 0.00
R7250:Rgs12 UTSW 5 34965497 missense probably damaging 1.00
R7276:Rgs12 UTSW 5 35026371 missense probably benign 0.06
R7444:Rgs12 UTSW 5 35025943 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- GCCCTTGAGAAAAGAGCTGTG -3'
(R):5'- GCAGAAATGTCACCGTTCTTTAAAG -3'

Sequencing Primer
(F):5'- GAGCTGTGAGGCAGATGGC -3'
(R):5'- GTCAGTAAGAAGCATCCCTCATCG -3'
Posted On2018-05-04