Incidental Mutation 'R6401:Ext1'
ID 516176
Institutional Source Beutler Lab
Gene Symbol Ext1
Ensembl Gene ENSMUSG00000061731
Gene Name exostoses (multiple) 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6401 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 53064038-53346159 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 53106097 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 365 (E365G)
Ref Sequence ENSEMBL: ENSMUSP00000076505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077273] [ENSMUST00000110244] [ENSMUST00000133362]
AlphaFold P97464
Predicted Effect possibly damaging
Transcript: ENSMUST00000077273
AA Change: E365G

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076505
Gene: ENSMUSG00000061731
AA Change: E365G

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
low complexity region 29 41 N/A INTRINSIC
Pfam:Exostosin 110 396 6e-64 PFAM
Pfam:Glyco_transf_64 480 729 1.1e-106 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110244
SMART Domains Protein: ENSMUSP00000105873
Gene: ENSMUSG00000061731

DomainStartEndE-ValueType
Pfam:Exostosin 4 82 1.1e-29 PFAM
Pfam:Glyco_transf_64 166 239 2.3e-18 PFAM
Predicted Effect silent
Transcript: ENSMUST00000133362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140798
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 93% (41/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum-resident type II transmembrane glycosyltransferase involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type I form of multiple exostoses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a lethal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano3 T A 2: 110,775,114 N249I probably benign Het
Ap3s1 A C 18: 46,758,007 I56L probably benign Het
Cngb1 A G 8: 95,303,739 probably benign Het
Col2a1 T C 15: 97,985,892 T570A unknown Het
Cyp3a16 T C 5: 145,440,364 E471G probably damaging Het
D930020B18Rik A G 10: 121,641,857 N14D possibly damaging Het
Fbn1 C A 2: 125,346,450 V1490F probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm4869 A T 5: 140,456,943 T80S possibly damaging Het
Gm5431 T A 11: 48,888,709 N740I probably benign Het
Ifi209 T C 1: 173,644,703 M370T probably damaging Het
Ighv2-4 G T 12: 113,653,462 P60Q probably damaging Het
Ldb3 A T 14: 34,577,334 L111Q probably benign Het
Mcmbp G T 7: 128,707,059 L413I possibly damaging Het
Mib1 T A 18: 10,795,802 M721K probably benign Het
Nos3 A G 5: 24,379,811 T738A probably benign Het
Notch3 T A 17: 32,158,623 I160L probably benign Het
Nrxn3 C A 12: 89,255,000 N516K possibly damaging Het
Nt5c2 A G 19: 46,889,811 Y496H probably benign Het
Olfr1465 T C 19: 13,313,514 Y257C probably damaging Het
Olfr275 A C 4: 52,826,242 T282P probably damaging Het
Olfr351 A T 2: 36,860,165 L61* probably null Het
Polm A T 11: 5,829,491 W436R probably damaging Het
Prex2 T A 1: 11,186,727 I1221N probably benign Het
Rfpl4b T C 10: 38,820,945 H220R possibly damaging Het
Rgs12 T C 5: 35,020,332 F79L probably damaging Het
Rxfp2 A G 5: 150,043,130 D111G probably benign Het
Smg7 A G 1: 152,840,136 probably null Het
Spata22 T C 11: 73,333,354 S34P probably damaging Het
St7 T A 6: 17,855,318 probably null Het
Stk31 A G 6: 49,423,438 E399G probably damaging Het
Tcp10b C A 17: 13,073,579 N296K probably damaging Het
Tonsl T C 15: 76,633,666 Y645C probably damaging Het
Ttn A T 2: 76,969,862 M334K probably benign Het
Vcpkmt C A 12: 69,582,845 V48F probably damaging Het
Vmn2r112 T A 17: 22,603,551 Y403* probably null Het
Vwa7 G A 17: 35,017,310 probably null Het
Wisp2 T C 2: 163,829,026 I151T probably benign Het
Wscd2 A T 5: 113,588,145 *572C probably null Het
Xpo7 A G 14: 70,682,347 L676P probably damaging Het
Zbtb32 A C 7: 30,591,819 L17W probably damaging Het
Other mutations in Ext1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00710:Ext1 APN 15 53344873 missense probably damaging 1.00
IGL02081:Ext1 APN 15 53073446 nonsense probably null
IGL03147:Ext1 UTSW 15 53088072 missense probably damaging 0.98
R0047:Ext1 UTSW 15 53345146 missense probably benign
R0047:Ext1 UTSW 15 53345146 missense probably benign
R0437:Ext1 UTSW 15 53106106 missense probably damaging 1.00
R0881:Ext1 UTSW 15 53344483 missense probably benign 0.23
R1882:Ext1 UTSW 15 53075792 missense probably damaging 1.00
R2135:Ext1 UTSW 15 53101744 missense possibly damaging 0.88
R2175:Ext1 UTSW 15 53068728 missense probably damaging 1.00
R2762:Ext1 UTSW 15 53344927 missense probably benign 0.29
R3162:Ext1 UTSW 15 53344604 missense possibly damaging 0.82
R3162:Ext1 UTSW 15 53344604 missense possibly damaging 0.82
R3752:Ext1 UTSW 15 53075910 missense probably damaging 1.00
R3815:Ext1 UTSW 15 53345089 missense probably benign 0.05
R4096:Ext1 UTSW 15 53073357 missense probably damaging 1.00
R4298:Ext1 UTSW 15 53345125 missense probably benign 0.02
R4362:Ext1 UTSW 15 53107591 intron probably benign
R4550:Ext1 UTSW 15 53101786 missense probably damaging 0.99
R4647:Ext1 UTSW 15 53089987 missense possibly damaging 0.95
R4648:Ext1 UTSW 15 53089987 missense possibly damaging 0.95
R4871:Ext1 UTSW 15 53092377 missense probably benign 0.37
R4954:Ext1 UTSW 15 53344492 missense probably damaging 1.00
R5010:Ext1 UTSW 15 53092412 missense probably damaging 1.00
R5153:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5155:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5328:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5385:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5542:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5555:Ext1 UTSW 15 53088143 missense probably damaging 1.00
R5779:Ext1 UTSW 15 53344553 missense probably damaging 0.99
R5874:Ext1 UTSW 15 53101752 missense possibly damaging 0.61
R6604:Ext1 UTSW 15 53083159 missense probably damaging 0.99
R6847:Ext1 UTSW 15 53345154 missense probably benign
R6885:Ext1 UTSW 15 53101692 missense probably damaging 1.00
R7212:Ext1 UTSW 15 53345162 missense probably benign 0.00
R7315:Ext1 UTSW 15 53073387 missense probably damaging 1.00
R7361:Ext1 UTSW 15 53344723 missense probably damaging 1.00
R7474:Ext1 UTSW 15 53344489 missense probably damaging 0.98
R7853:Ext1 UTSW 15 53107485 missense probably damaging 0.96
R7860:Ext1 UTSW 15 53089939 missense possibly damaging 0.84
R8013:Ext1 UTSW 15 53075887 missense possibly damaging 0.78
R8014:Ext1 UTSW 15 53075887 missense possibly damaging 0.78
R8725:Ext1 UTSW 15 53344669 missense possibly damaging 0.91
R8888:Ext1 UTSW 15 53092327 missense probably damaging 1.00
R9162:Ext1 UTSW 15 53345108 nonsense probably null
R9342:Ext1 UTSW 15 53345128 missense probably benign
R9587:Ext1 UTSW 15 53092412 missense possibly damaging 0.53
R9663:Ext1 UTSW 15 53345060 missense probably damaging 0.96
R9753:Ext1 UTSW 15 53344671 missense probably damaging 1.00
X0021:Ext1 UTSW 15 53345273 missense probably benign
Predicted Primers PCR Primer
(F):5'- GACACAGGCAATTTTCTCCTG -3'
(R):5'- TCCCATGTGACCTGGTAATTCTG -3'

Sequencing Primer
(F):5'- TGGGGGCAGCAATAATCT -3'
(R):5'- CATGTGACCTGGTAATTCTGAGTCAC -3'
Posted On 2018-05-04