Incidental Mutation 'R6402:Kansl1l'
ID516187
Institutional Source Beutler Lab
Gene Symbol Kansl1l
Ensembl Gene ENSMUSG00000026004
Gene NameKAT8 regulatory NSL complex subunit 1-like
Synonyms1110028C15Rik, C430010P07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R6402 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location66719248-66817562 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66762193 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 538 (H538L)
Ref Sequence ENSEMBL: ENSMUSP00000063843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068168] [ENSMUST00000113987]
Predicted Effect probably damaging
Transcript: ENSMUST00000068168
AA Change: H538L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063843
Gene: ENSMUSG00000026004
AA Change: H538L

DomainStartEndE-ValueType
low complexity region 340 355 N/A INTRINSIC
low complexity region 491 507 N/A INTRINSIC
low complexity region 518 535 N/A INTRINSIC
PEHE 755 875 2.42e-33 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113987
AA Change: H538L

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109620
Gene: ENSMUSG00000026004
AA Change: H538L

DomainStartEndE-ValueType
low complexity region 340 355 N/A INTRINSIC
low complexity region 491 507 N/A INTRINSIC
low complexity region 518 535 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000129190
AA Change: H193L
SMART Domains Protein: ENSMUSP00000118603
Gene: ENSMUSG00000026004
AA Change: H193L

DomainStartEndE-ValueType
low complexity region 31 46 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
low complexity region 174 191 N/A INTRINSIC
PEHE 455 575 2.42e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195411
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 T A 9: 104,098,945 I268F possibly damaging Het
Adck2 T C 6: 39,586,869 V514A possibly damaging Het
Catsper1 G T 19: 5,339,496 G480W probably damaging Het
Cbarp A G 10: 80,135,122 I247T probably benign Het
Cdc14a A G 3: 116,348,459 Y172H probably damaging Het
Creld2 C T 15: 88,823,141 R221C probably damaging Het
Dmac1 C T 4: 75,277,980 probably null Het
Epsti1 A G 14: 77,939,878 E166G probably damaging Het
Hus1 A G 11: 9,010,407 F64S probably damaging Het
Map4k2 T C 19: 6,344,081 probably null Het
Mettl8 A T 2: 70,966,461 Y98* probably null Het
Naip6 G T 13: 100,300,718 H432Q probably benign Het
Sirt4 C T 5: 115,480,311 V235M probably damaging Het
Slc23a3 T C 1: 75,128,556 N456S probably damaging Het
Slc9a1 C A 4: 133,370,651 H36Q probably benign Het
Spink14 A G 18: 44,030,974 T70A probably damaging Het
Stambpl1 C A 19: 34,234,139 P200Q probably benign Het
Trio T A 15: 27,902,911 I155L probably benign Het
Ttc37 A G 13: 76,135,270 H827R probably benign Het
Vmn1r51 T C 6: 90,129,462 V120A probably benign Het
Wac A G 18: 7,901,585 S77G possibly damaging Het
Zeb2 G A 2: 44,996,975 T675I probably damaging Het
Other mutations in Kansl1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Kansl1l APN 1 66724574 missense possibly damaging 0.83
IGL00825:Kansl1l APN 1 66801512 missense probably benign
IGL01644:Kansl1l APN 1 66801316 missense probably benign 0.01
IGL01690:Kansl1l APN 1 66801073 missense probably damaging 0.98
IGL01811:Kansl1l APN 1 66723303 missense probably damaging 1.00
IGL01966:Kansl1l APN 1 66738068 missense probably damaging 1.00
IGL02549:Kansl1l APN 1 66801968 missense probably benign 0.44
IGL02578:Kansl1l APN 1 66801689 nonsense probably null
IGL02707:Kansl1l APN 1 66773445 missense probably damaging 1.00
IGL03088:Kansl1l APN 1 66735725 missense probably damaging 0.98
IGL03187:Kansl1l APN 1 66725903 missense probably damaging 1.00
IGL03279:Kansl1l APN 1 66735666 missense probably damaging 0.99
arkansasii UTSW 1 66762103 missense probably damaging 1.00
Kansasii UTSW 1 66778106 missense probably null 0.41
PIT4810001:Kansl1l UTSW 1 66762149 missense probably damaging 1.00
R0068:Kansl1l UTSW 1 66720888 missense probably benign 0.00
R0068:Kansl1l UTSW 1 66720888 missense probably benign 0.00
R0070:Kansl1l UTSW 1 66801103 missense probably damaging 0.99
R0312:Kansl1l UTSW 1 66778106 missense probably null 0.41
R0456:Kansl1l UTSW 1 66735726 missense probably damaging 0.99
R0720:Kansl1l UTSW 1 66801356 missense possibly damaging 0.52
R1381:Kansl1l UTSW 1 66720904 missense probably benign 0.01
R1470:Kansl1l UTSW 1 66801997 missense possibly damaging 0.82
R1470:Kansl1l UTSW 1 66801997 missense possibly damaging 0.82
R1759:Kansl1l UTSW 1 66801888 missense probably damaging 0.96
R1840:Kansl1l UTSW 1 66778032 missense probably damaging 1.00
R2299:Kansl1l UTSW 1 66773477 missense probably damaging 1.00
R2888:Kansl1l UTSW 1 66724605 missense probably benign 0.13
R2893:Kansl1l UTSW 1 66801334 missense probably damaging 1.00
R3735:Kansl1l UTSW 1 66801250 missense possibly damaging 0.90
R4249:Kansl1l UTSW 1 66773478 missense probably damaging 1.00
R4448:Kansl1l UTSW 1 66738159 missense probably damaging 0.99
R4710:Kansl1l UTSW 1 66801496 missense possibly damaging 0.66
R4768:Kansl1l UTSW 1 66801133 missense probably damaging 1.00
R5523:Kansl1l UTSW 1 66802112 missense probably benign 0.00
R5645:Kansl1l UTSW 1 66801344 missense probably benign 0.27
R5840:Kansl1l UTSW 1 66770215 intron probably benign
R5964:Kansl1l UTSW 1 66725922 missense probably damaging 1.00
R5990:Kansl1l UTSW 1 66735726 missense probably damaging 0.98
R6009:Kansl1l UTSW 1 66735600 missense probably benign 0.00
R6051:Kansl1l UTSW 1 66726726 missense probably null 1.00
R6092:Kansl1l UTSW 1 66773484 missense probably damaging 1.00
R6316:Kansl1l UTSW 1 66735585 missense probably benign
R6906:Kansl1l UTSW 1 66723278 missense possibly damaging 0.76
R7241:Kansl1l UTSW 1 66801628 missense possibly damaging 0.91
R7434:Kansl1l UTSW 1 66762103 missense probably damaging 1.00
R7716:Kansl1l UTSW 1 66801133 missense probably damaging 1.00
R7793:Kansl1l UTSW 1 66778014 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCATGATTTCCCAAATGCAGCC -3'
(R):5'- TGATGTACTTCACCGTCATGC -3'

Sequencing Primer
(F):5'- AAATGCAGCCTTACCTCGGGAG -3'
(R):5'- GATGTACTTCACCGTCATGCAAAAAG -3'
Posted On2018-05-04