Mutagenetix > Incidental Mutation

Incidental Mutation 'R6402:Kansl1l'

516187

Institutional Source

Beutler Lab

Gene Symbol

Kansl1l

Ensembl Gene

ENSMUSG00000026004

Gene Name

KAT8 regulatory NSL complex subunit 1-like

Synonyms

1110028C15Rik, C430010P07Rik

MMRRC Submission

044419-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.177) question?

Stock #

R6402 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

66758407-66856721 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 66801352 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 538 (H538L)

Ref Sequence

ENSEMBL: ENSMUSP00000063843 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068168] [ENSMUST00000113987]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000068168
AA Change: H538L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000063843
Gene: ENSMUSG00000026004
AA Change: H538L

Domain	Start	End	E-Value	Type
low complexity region	340	355	N/A	INTRINSIC
low complexity region	491	507	N/A	INTRINSIC
low complexity region	518	535	N/A	INTRINSIC
PEHE	755	875	2.42e-33	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000113987
AA Change: H538L

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000109620
Gene: ENSMUSG00000026004
AA Change: H538L

Domain	Start	End	E-Value	Type
low complexity region	340	355	N/A	INTRINSIC
low complexity region	491	507	N/A	INTRINSIC
low complexity region	518	535	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000129190
AA Change: H193L

SMART Domains

Protein: ENSMUSP00000118603
Gene: ENSMUSG00000026004
AA Change: H193L

Domain	Start	End	E-Value	Type
low complexity region	31	46	N/A	INTRINSIC
low complexity region	147	163	N/A	INTRINSIC
low complexity region	174	191	N/A	INTRINSIC
PEHE	455	575	2.42e-33	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195411

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ackr4	T	A	9: 103,976,144 (GRCm39)	I268F	possibly damaging	Het
Adck2	T	C	6: 39,563,803 (GRCm39)	V514A	possibly damaging	Het
Catsper1	G	T	19: 5,389,524 (GRCm39)	G480W	probably damaging	Het
Cbarp	A	G	10: 79,970,956 (GRCm39)	I247T	probably benign	Het
Cdc14a	A	G	3: 116,142,108 (GRCm39)	Y172H	probably damaging	Het
Creld2	C	T	15: 88,707,344 (GRCm39)	R221C	probably damaging	Het
Dmac1	C	T	4: 75,196,217 (GRCm39)		probably null	Het
Epsti1	A	G	14: 78,177,318 (GRCm39)	E166G	probably damaging	Het
Hus1	A	G	11: 8,960,407 (GRCm39)	F64S	probably damaging	Het
Map4k2	T	C	19: 6,394,111 (GRCm39)		probably null	Het
Mettl8	A	T	2: 70,796,805 (GRCm39)	Y98*	probably null	Het
Naip6	G	T	13: 100,437,226 (GRCm39)	H432Q	probably benign	Het
Sirt4	C	T	5: 115,618,370 (GRCm39)	V235M	probably damaging	Het
Skic3	A	G	13: 76,283,389 (GRCm39)	H827R	probably benign	Het
Slc23a3	T	C	1: 75,105,200 (GRCm39)	N456S	probably damaging	Het
Slc9a1	C	A	4: 133,097,962 (GRCm39)	H36Q	probably benign	Het
Spink14	A	G	18: 44,164,041 (GRCm39)	T70A	probably damaging	Het
Stambpl1	C	A	19: 34,211,539 (GRCm39)	P200Q	probably benign	Het
Trio	T	A	15: 27,902,997 (GRCm39)	I155L	probably benign	Het
Vmn1r51	T	C	6: 90,106,444 (GRCm39)	V120A	probably benign	Het
Wac	A	G	18: 7,901,585 (GRCm39)	S77G	possibly damaging	Het
Zeb2	G	A	2: 44,886,987 (GRCm39)	T675I	probably damaging	Het

Other mutations in Kansl1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00576:Kansl1l	APN	1	66,763,733 (GRCm39)	missense	possibly damaging	0.83
IGL00825:Kansl1l	APN	1	66,840,671 (GRCm39)	missense	probably benign
IGL01644:Kansl1l	APN	1	66,840,475 (GRCm39)	missense	probably benign	0.01
IGL01690:Kansl1l	APN	1	66,840,232 (GRCm39)	missense	probably damaging	0.98
IGL01811:Kansl1l	APN	1	66,762,462 (GRCm39)	missense	probably damaging	1.00
IGL01966:Kansl1l	APN	1	66,777,227 (GRCm39)	missense	probably damaging	1.00
IGL02549:Kansl1l	APN	1	66,841,127 (GRCm39)	missense	probably benign	0.44
IGL02578:Kansl1l	APN	1	66,840,848 (GRCm39)	nonsense	probably null
IGL02707:Kansl1l	APN	1	66,812,604 (GRCm39)	missense	probably damaging	1.00
IGL03088:Kansl1l	APN	1	66,774,884 (GRCm39)	missense	probably damaging	0.98
IGL03187:Kansl1l	APN	1	66,765,062 (GRCm39)	missense	probably damaging	1.00
IGL03279:Kansl1l	APN	1	66,774,825 (GRCm39)	missense	probably damaging	0.99
arkansasii	UTSW	1	66,801,262 (GRCm39)	missense	probably damaging	1.00
Kansasii	UTSW	1	66,817,265 (GRCm39)	missense	probably null	0.41
PIT4810001:Kansl1l	UTSW	1	66,801,308 (GRCm39)	missense	probably damaging	1.00
R0068:Kansl1l	UTSW	1	66,760,047 (GRCm39)	missense	probably benign	0.00
R0068:Kansl1l	UTSW	1	66,760,047 (GRCm39)	missense	probably benign	0.00
R0070:Kansl1l	UTSW	1	66,840,262 (GRCm39)	missense	probably damaging	0.99
R0312:Kansl1l	UTSW	1	66,817,265 (GRCm39)	missense	probably null	0.41
R0456:Kansl1l	UTSW	1	66,774,885 (GRCm39)	missense	probably damaging	0.99
R0720:Kansl1l	UTSW	1	66,840,515 (GRCm39)	missense	possibly damaging	0.52
R1381:Kansl1l	UTSW	1	66,760,063 (GRCm39)	missense	probably benign	0.01
R1470:Kansl1l	UTSW	1	66,841,156 (GRCm39)	missense	possibly damaging	0.82
R1470:Kansl1l	UTSW	1	66,841,156 (GRCm39)	missense	possibly damaging	0.82
R1759:Kansl1l	UTSW	1	66,841,047 (GRCm39)	missense	probably damaging	0.96
R1840:Kansl1l	UTSW	1	66,817,191 (GRCm39)	missense	probably damaging	1.00
R2299:Kansl1l	UTSW	1	66,812,636 (GRCm39)	missense	probably damaging	1.00
R2888:Kansl1l	UTSW	1	66,763,764 (GRCm39)	missense	probably benign	0.13
R2893:Kansl1l	UTSW	1	66,840,493 (GRCm39)	missense	probably damaging	1.00
R3735:Kansl1l	UTSW	1	66,840,409 (GRCm39)	missense	possibly damaging	0.90
R4249:Kansl1l	UTSW	1	66,812,637 (GRCm39)	missense	probably damaging	1.00
R4448:Kansl1l	UTSW	1	66,777,318 (GRCm39)	missense	probably damaging	0.99
R4710:Kansl1l	UTSW	1	66,840,655 (GRCm39)	missense	possibly damaging	0.66
R4768:Kansl1l	UTSW	1	66,840,292 (GRCm39)	missense	probably damaging	1.00
R5523:Kansl1l	UTSW	1	66,841,271 (GRCm39)	missense	probably benign	0.00
R5645:Kansl1l	UTSW	1	66,840,503 (GRCm39)	missense	probably benign	0.27
R5840:Kansl1l	UTSW	1	66,809,374 (GRCm39)	intron	probably benign
R5964:Kansl1l	UTSW	1	66,765,081 (GRCm39)	missense	probably damaging	1.00
R5990:Kansl1l	UTSW	1	66,774,885 (GRCm39)	missense	probably damaging	0.98
R6009:Kansl1l	UTSW	1	66,774,759 (GRCm39)	missense	probably benign	0.00
R6051:Kansl1l	UTSW	1	66,765,885 (GRCm39)	missense	probably null	1.00
R6092:Kansl1l	UTSW	1	66,812,643 (GRCm39)	missense	probably damaging	1.00
R6316:Kansl1l	UTSW	1	66,774,744 (GRCm39)	missense	probably benign
R6906:Kansl1l	UTSW	1	66,762,437 (GRCm39)	missense	possibly damaging	0.76
R7241:Kansl1l	UTSW	1	66,840,787 (GRCm39)	missense	possibly damaging	0.91
R7434:Kansl1l	UTSW	1	66,801,262 (GRCm39)	missense	probably damaging	1.00
R7716:Kansl1l	UTSW	1	66,840,292 (GRCm39)	missense	probably damaging	1.00
R7793:Kansl1l	UTSW	1	66,817,173 (GRCm39)	missense	probably damaging	1.00
R8187:Kansl1l	UTSW	1	66,840,896 (GRCm39)	missense	possibly damaging	0.77
R8972:Kansl1l	UTSW	1	66,812,101 (GRCm39)	missense	probably damaging	1.00
R9347:Kansl1l	UTSW	1	66,840,347 (GRCm39)	missense	probably benign	0.14
R9386:Kansl1l	UTSW	1	66,765,129 (GRCm39)	missense	probably damaging	1.00
R9749:Kansl1l	UTSW	1	66,760,970 (GRCm39)	missense	probably damaging	1.00
R9750:Kansl1l	UTSW	1	66,817,150 (GRCm39)	missense	probably benign	0.36

Predicted Primers

PCR Primer
(F):5'- CTTCATGATTTCCCAAATGCAGCC -3'
(R):5'- TGATGTACTTCACCGTCATGC -3'

Sequencing Primer
(F):5'- AAATGCAGCCTTACCTCGGGAG -3'
(R):5'- GATGTACTTCACCGTCATGCAAAAAG -3'

Posted On

2018-05-04