Incidental Mutation 'R6402:Slc23a3'
ID516188
Institutional Source Beutler Lab
Gene Symbol Slc23a3
Ensembl Gene ENSMUSG00000026205
Gene Namesolute carrier family 23 (nucleobase transporters), member 3
SynonymsSVCT3, Yspl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6402 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location75125541-75133890 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75128556 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 456 (N456S)
Ref Sequence ENSEMBL: ENSMUSP00000027405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027405]
Predicted Effect probably damaging
Transcript: ENSMUST00000027405
AA Change: N456S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027405
Gene: ENSMUSG00000026205
AA Change: N456S

DomainStartEndE-ValueType
low complexity region 20 30 N/A INTRINSIC
Pfam:Xan_ur_permease 50 122 4.6e-12 PFAM
Pfam:Xan_ur_permease 115 476 2.3e-100 PFAM
transmembrane domain 490 512 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188080
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 T A 9: 104,098,945 I268F possibly damaging Het
Adck2 T C 6: 39,586,869 V514A possibly damaging Het
Catsper1 G T 19: 5,339,496 G480W probably damaging Het
Cbarp A G 10: 80,135,122 I247T probably benign Het
Cdc14a A G 3: 116,348,459 Y172H probably damaging Het
Creld2 C T 15: 88,823,141 R221C probably damaging Het
Dmac1 C T 4: 75,277,980 probably null Het
Epsti1 A G 14: 77,939,878 E166G probably damaging Het
Hus1 A G 11: 9,010,407 F64S probably damaging Het
Kansl1l T A 1: 66,762,193 H538L probably damaging Het
Map4k2 T C 19: 6,344,081 probably null Het
Mettl8 A T 2: 70,966,461 Y98* probably null Het
Naip6 G T 13: 100,300,718 H432Q probably benign Het
Sirt4 C T 5: 115,480,311 V235M probably damaging Het
Slc9a1 C A 4: 133,370,651 H36Q probably benign Het
Spink14 A G 18: 44,030,974 T70A probably damaging Het
Stambpl1 C A 19: 34,234,139 P200Q probably benign Het
Trio T A 15: 27,902,911 I155L probably benign Het
Ttc37 A G 13: 76,135,270 H827R probably benign Het
Vmn1r51 T C 6: 90,129,462 V120A probably benign Het
Wac A G 18: 7,901,585 S77G possibly damaging Het
Zeb2 G A 2: 44,996,975 T675I probably damaging Het
Other mutations in Slc23a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Slc23a3 APN 1 75133281 missense possibly damaging 0.92
R0468:Slc23a3 UTSW 1 75133230 missense possibly damaging 0.82
R3858:Slc23a3 UTSW 1 75129396 critical splice donor site probably null
R3913:Slc23a3 UTSW 1 75128922 missense probably benign 0.44
R4060:Slc23a3 UTSW 1 75133320 unclassified probably benign
R4592:Slc23a3 UTSW 1 75128556 missense probably damaging 1.00
R4937:Slc23a3 UTSW 1 75132624 missense probably damaging 1.00
R4940:Slc23a3 UTSW 1 75133803 unclassified probably null
R6213:Slc23a3 UTSW 1 75131748 missense probably benign
R6644:Slc23a3 UTSW 1 75128547 missense probably damaging 0.98
R7068:Slc23a3 UTSW 1 75133233 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTACACGCAAAATCCCACTGTG -3'
(R):5'- TTGTTTTCTTAGCTGAACCGAGTC -3'

Sequencing Primer
(F):5'- ACTGTGAGACCAAGAATCCAG -3'
(R):5'- CTGAACCGAGTCTCTTGGAGAATC -3'
Posted On2018-05-04