Incidental Mutation 'R6402:Zeb2'
ID516189
Institutional Source Beutler Lab
Gene Symbol Zeb2
Ensembl Gene ENSMUSG00000026872
Gene Namezinc finger E-box binding homeobox 2
SynonymsZfhx1b, Zfx1b, SIP1, 9130203F04Rik, D130016B08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6402 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location44983632-45117395 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44996975 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 675 (T675I)
Ref Sequence ENSEMBL: ENSMUSP00000144637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028229] [ENSMUST00000068415] [ENSMUST00000076836] [ENSMUST00000176438] [ENSMUST00000176732] [ENSMUST00000177302] [ENSMUST00000200844] [ENSMUST00000201211] [ENSMUST00000201623] [ENSMUST00000201804]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028229
AA Change: T690I

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028229
Gene: ENSMUSG00000026872
AA Change: T690I

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000068415
AA Change: T646I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000069685
Gene: ENSMUSG00000026872
AA Change: T646I

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000076836
AA Change: T645I

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000076111
Gene: ENSMUSG00000026872
AA Change: T645I

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 210 233 2.09e-3 SMART
ZnF_C2H2 240 262 9.88e-5 SMART
ZnF_C2H2 281 303 4.87e-4 SMART
ZnF_C2H2 309 329 1.86e1 SMART
low complexity region 351 363 N/A INTRINSIC
ZnF_C2H2 580 600 5.54e1 SMART
HOX 643 705 2.05e-3 SMART
low complexity region 777 807 N/A INTRINSIC
low complexity region 840 855 N/A INTRINSIC
low complexity region 869 880 N/A INTRINSIC
ZnF_C2H2 998 1020 4.47e-3 SMART
ZnF_C2H2 1026 1048 2.17e-1 SMART
ZnF_C2H2 1054 1075 1.89e-1 SMART
low complexity region 1082 1096 N/A INTRINSIC
low complexity region 1133 1149 N/A INTRINSIC
low complexity region 1157 1167 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176438
AA Change: T646I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134849
Gene: ENSMUSG00000026872
AA Change: T646I

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176732
SMART Domains Protein: ENSMUSP00000135393
Gene: ENSMUSG00000026872

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
ZnF_C2H2 60 83 2.09e-3 SMART
ZnF_C2H2 90 112 9.88e-5 SMART
ZnF_C2H2 131 153 4.87e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177302
AA Change: T646I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134747
Gene: ENSMUSG00000026872
AA Change: T646I

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200844
AA Change: T622I

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144421
Gene: ENSMUSG00000026872
AA Change: T622I

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 187 210 9.2e-6 SMART
ZnF_C2H2 217 239 4.2e-7 SMART
ZnF_C2H2 258 280 2e-6 SMART
ZnF_C2H2 286 306 8e-2 SMART
low complexity region 328 340 N/A INTRINSIC
ZnF_C2H2 557 577 2.4e-1 SMART
HOX 620 682 1.1e-5 SMART
low complexity region 754 784 N/A INTRINSIC
low complexity region 817 832 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
ZnF_C2H2 975 997 1.9e-5 SMART
ZnF_C2H2 1003 1025 9.6e-4 SMART
ZnF_C2H2 1031 1052 7.9e-4 SMART
low complexity region 1059 1073 N/A INTRINSIC
low complexity region 1110 1126 N/A INTRINSIC
low complexity region 1134 1144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201211
SMART Domains Protein: ENSMUSP00000144406
Gene: ENSMUSG00000026872

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201623
SMART Domains Protein: ENSMUSP00000144075
Gene: ENSMUSG00000026872

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 187 210 9.2e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201804
AA Change: T675I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144637
Gene: ENSMUSG00000026872
AA Change: T675I

DomainStartEndE-ValueType
low complexity region 107 119 N/A INTRINSIC
ZnF_C2H2 240 263 9.2e-6 SMART
ZnF_C2H2 270 292 4.2e-7 SMART
ZnF_C2H2 311 333 2e-6 SMART
ZnF_C2H2 339 359 8e-2 SMART
low complexity region 381 393 N/A INTRINSIC
ZnF_C2H2 610 630 2.4e-1 SMART
HOX 673 731 1.2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209076
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Zfh1 family of 2-handed zinc finger/homeodomain proteins. It is located in the nucleus and functions as a DNA-binding transcriptional repressor that interacts with activated SMADs. Mutations in this gene are associated with Hirschsprung disease/Mowat-Wilson syndrome. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous null mutants exhibit a variety of defects at embryonic day 8.5 and die between embryonic days 9.5 and 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 T A 9: 104,098,945 I268F possibly damaging Het
Adck2 T C 6: 39,586,869 V514A possibly damaging Het
Catsper1 G T 19: 5,339,496 G480W probably damaging Het
Cbarp A G 10: 80,135,122 I247T probably benign Het
Cdc14a A G 3: 116,348,459 Y172H probably damaging Het
Creld2 C T 15: 88,823,141 R221C probably damaging Het
Dmac1 C T 4: 75,277,980 probably null Het
Epsti1 A G 14: 77,939,878 E166G probably damaging Het
Hus1 A G 11: 9,010,407 F64S probably damaging Het
Kansl1l T A 1: 66,762,193 H538L probably damaging Het
Map4k2 T C 19: 6,344,081 probably null Het
Mettl8 A T 2: 70,966,461 Y98* probably null Het
Naip6 G T 13: 100,300,718 H432Q probably benign Het
Sirt4 C T 5: 115,480,311 V235M probably damaging Het
Slc23a3 T C 1: 75,128,556 N456S probably damaging Het
Slc9a1 C A 4: 133,370,651 H36Q probably benign Het
Spink14 A G 18: 44,030,974 T70A probably damaging Het
Stambpl1 C A 19: 34,234,139 P200Q probably benign Het
Trio T A 15: 27,902,911 I155L probably benign Het
Ttc37 A G 13: 76,135,270 H827R probably benign Het
Vmn1r51 T C 6: 90,129,462 V120A probably benign Het
Wac A G 18: 7,901,585 S77G possibly damaging Het
Other mutations in Zeb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Zeb2 APN 2 44997275 missense probably damaging 1.00
IGL01639:Zeb2 APN 2 44997257 missense probably benign
IGL02016:Zeb2 APN 2 44988874 missense possibly damaging 0.71
IGL02337:Zeb2 APN 2 44997230 missense probably damaging 0.96
IGL02745:Zeb2 APN 2 44994475 unclassified probably benign
IGL02893:Zeb2 APN 2 44996607 missense probably benign 0.03
IGL03412:Zeb2 APN 2 45002708 intron probably benign
Dropped UTSW 2 45110041 missense possibly damaging 0.66
Okapi UTSW 2 44997156 missense probably damaging 1.00
sable UTSW 2 44997318 missense probably damaging 1.00
R0514:Zeb2 UTSW 2 45002647 missense possibly damaging 0.52
R0603:Zeb2 UTSW 2 45017426 missense probably benign 0.45
R0608:Zeb2 UTSW 2 44996126 missense possibly damaging 0.87
R1236:Zeb2 UTSW 2 44994646 missense probably damaging 1.00
R1529:Zeb2 UTSW 2 44997194 missense probably damaging 1.00
R1581:Zeb2 UTSW 2 44997000 missense probably damaging 0.99
R1636:Zeb2 UTSW 2 45002611 missense probably damaging 1.00
R1924:Zeb2 UTSW 2 45002612 missense probably damaging 1.00
R2012:Zeb2 UTSW 2 44997950 missense probably damaging 1.00
R2097:Zeb2 UTSW 2 44997156 missense probably damaging 1.00
R2156:Zeb2 UTSW 2 44988809 missense probably benign 0.20
R4385:Zeb2 UTSW 2 45023062 missense probably damaging 1.00
R4472:Zeb2 UTSW 2 45023011 missense probably damaging 1.00
R4678:Zeb2 UTSW 2 44996341 missense probably damaging 0.99
R4769:Zeb2 UTSW 2 44996435 missense probably damaging 1.00
R4816:Zeb2 UTSW 2 44997768 missense probably damaging 0.99
R4918:Zeb2 UTSW 2 44996882 missense probably damaging 1.00
R4969:Zeb2 UTSW 2 44998919 missense probably damaging 1.00
R5191:Zeb2 UTSW 2 45002600 missense probably benign 0.00
R5195:Zeb2 UTSW 2 45001635 missense probably damaging 1.00
R5322:Zeb2 UTSW 2 44997095 missense probably damaging 1.00
R5699:Zeb2 UTSW 2 44997788 missense probably damaging 1.00
R5750:Zeb2 UTSW 2 44997518 missense probably damaging 0.96
R5764:Zeb2 UTSW 2 44996919 missense possibly damaging 0.89
R5914:Zeb2 UTSW 2 44997052 missense probably benign 0.00
R5918:Zeb2 UTSW 2 45111259 intron probably benign
R6037:Zeb2 UTSW 2 44988640 nonsense probably null
R6037:Zeb2 UTSW 2 44988640 nonsense probably null
R6302:Zeb2 UTSW 2 44997759 missense probably benign 0.18
R6372:Zeb2 UTSW 2 45002539 missense probably damaging 1.00
R6492:Zeb2 UTSW 2 45110496 intron probably benign
R6554:Zeb2 UTSW 2 44997512 missense probably damaging 1.00
R6675:Zeb2 UTSW 2 44997445 nonsense probably null
R6735:Zeb2 UTSW 2 45110016 missense probably null 0.99
R6870:Zeb2 UTSW 2 44988910 missense probably damaging 0.98
R6925:Zeb2 UTSW 2 44994529 missense probably damaging 1.00
R6963:Zeb2 UTSW 2 44988799 missense probably damaging 0.97
R6972:Zeb2 UTSW 2 44997318 missense probably damaging 1.00
R7144:Zeb2 UTSW 2 45110041 missense possibly damaging 0.66
R7178:Zeb2 UTSW 2 44996994 missense probably damaging 0.97
R7379:Zeb2 UTSW 2 45001817 splice site probably null
R7419:Zeb2 UTSW 2 44996347 missense probably benign 0.20
R7580:Zeb2 UTSW 2 44994532 missense probably damaging 1.00
R7599:Zeb2 UTSW 2 44994613 missense probably damaging 1.00
R7625:Zeb2 UTSW 2 45002572 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGGCTTGGAGGTCCTTTC -3'
(R):5'- TTCATGCCAGTTCTGTAAAGAAAGC -3'

Sequencing Primer
(F):5'- TGGTGACCTGGAATTCGAATAC -3'
(R):5'- CAGTTCTGTAAAGAAAGCTTCCCGG -3'
Posted On2018-05-04