Incidental Mutation 'R6402:Mettl8'
ID516190
Institutional Source Beutler Lab
Gene Symbol Mettl8
Ensembl Gene ENSMUSG00000041975
Gene Namemethyltransferase like 8
SynonymsTIP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.804) question?
Stock #R6402 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location70964561-71055583 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 70966461 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 98 (Y98*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100037] [ENSMUST00000112179] [ENSMUST00000112186] [ENSMUST00000121586] [ENSMUST00000148876] [ENSMUST00000149181]
Predicted Effect probably null
Transcript: ENSMUST00000100037
AA Change: Y283*
SMART Domains Protein: ENSMUSP00000097615
Gene: ENSMUSG00000041975
AA Change: Y283*

DomainStartEndE-ValueType
Pfam:Methyltransf_23 115 304 1.4e-14 PFAM
Pfam:Ubie_methyltran 126 265 1.4e-7 PFAM
Pfam:Methyltransf_31 137 304 5.6e-10 PFAM
Pfam:Methyltransf_26 140 251 4.2e-8 PFAM
Pfam:Methyltransf_25 143 246 5.3e-13 PFAM
Pfam:Methyltransf_12 144 248 1e-12 PFAM
Pfam:Methyltransf_11 144 250 7.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112179
SMART Domains Protein: ENSMUSP00000107800
Gene: ENSMUSG00000041975

DomainStartEndE-ValueType
low complexity region 190 206 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112186
AA Change: Y330*
SMART Domains Protein: ENSMUSP00000107804
Gene: ENSMUSG00000041975
AA Change: Y330*

DomainStartEndE-ValueType
Pfam:Methyltransf_23 158 349 5.1e-15 PFAM
Pfam:Ubie_methyltran 173 312 8.7e-8 PFAM
Pfam:Methyltransf_31 184 348 3.7e-9 PFAM
Pfam:Methyltransf_25 190 293 3.9e-13 PFAM
Pfam:Methyltransf_12 191 295 7e-13 PFAM
Pfam:Methyltransf_11 191 297 6.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121586
SMART Domains Protein: ENSMUSP00000113642
Gene: ENSMUSG00000041975

DomainStartEndE-ValueType
Pfam:Methyltransf_25 190 279 1.4e-6 PFAM
Pfam:Methyltransf_11 191 280 5.6e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124781
Predicted Effect probably null
Transcript: ENSMUST00000140293
AA Change: Y98*
SMART Domains Protein: ENSMUSP00000118026
Gene: ENSMUSG00000041975
AA Change: Y98*

DomainStartEndE-ValueType
Pfam:Methyltransf_11 2 66 2.2e-8 PFAM
Pfam:Methyltransf_23 3 109 6.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148876
SMART Domains Protein: ENSMUSP00000115855
Gene: ENSMUSG00000041975

DomainStartEndE-ValueType
Pfam:Methyltransf_25 190 281 1.9e-8 PFAM
Pfam:Methyltransf_11 191 280 2.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149181
SMART Domains Protein: ENSMUSP00000119863
Gene: ENSMUSG00000041975

DomainStartEndE-ValueType
SCOP:d1af7_2 107 137 7e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: This locus encodes a member of the methyltransferase family, and is involved in chromatin remodeling. Transcripts from this locus can be induced or inhibited by cell stretch and affect cell differentiation in the myogenic or adipogenic pathways. Multiple transcript variants encoding different isoforms have been found for this gene. Additional splice variants have been described in the literature but they meet nonsense-mediated decay (NMD) criteria and are likely to be degraded as soon as they are transcribed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced 3-methylcytidine (m3C) methyltransferases modification of mRNA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 T A 9: 104,098,945 I268F possibly damaging Het
Adck2 T C 6: 39,586,869 V514A possibly damaging Het
Catsper1 G T 19: 5,339,496 G480W probably damaging Het
Cbarp A G 10: 80,135,122 I247T probably benign Het
Cdc14a A G 3: 116,348,459 Y172H probably damaging Het
Creld2 C T 15: 88,823,141 R221C probably damaging Het
Dmac1 C T 4: 75,277,980 probably null Het
Epsti1 A G 14: 77,939,878 E166G probably damaging Het
Hus1 A G 11: 9,010,407 F64S probably damaging Het
Kansl1l T A 1: 66,762,193 H538L probably damaging Het
Map4k2 T C 19: 6,344,081 probably null Het
Naip6 G T 13: 100,300,718 H432Q probably benign Het
Sirt4 C T 5: 115,480,311 V235M probably damaging Het
Slc23a3 T C 1: 75,128,556 N456S probably damaging Het
Slc9a1 C A 4: 133,370,651 H36Q probably benign Het
Spink14 A G 18: 44,030,974 T70A probably damaging Het
Stambpl1 C A 19: 34,234,139 P200Q probably benign Het
Trio T A 15: 27,902,911 I155L probably benign Het
Ttc37 A G 13: 76,135,270 H827R probably benign Het
Vmn1r51 T C 6: 90,129,462 V120A probably benign Het
Wac A G 18: 7,901,585 S77G possibly damaging Het
Zeb2 G A 2: 44,996,975 T675I probably damaging Het
Other mutations in Mettl8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00795:Mettl8 APN 2 70982090 missense probably damaging 1.00
IGL01370:Mettl8 APN 2 70982039 missense probably damaging 1.00
R1709:Mettl8 UTSW 2 70982151 missense probably benign 0.02
R1944:Mettl8 UTSW 2 70973279 missense probably damaging 1.00
R5107:Mettl8 UTSW 2 70965557 missense probably damaging 1.00
R5278:Mettl8 UTSW 2 70973297 missense probably damaging 1.00
R5629:Mettl8 UTSW 2 70965569 missense probably benign
R5864:Mettl8 UTSW 2 70982013 missense probably benign 0.10
R6272:Mettl8 UTSW 2 70976075 unclassified probably null
R6535:Mettl8 UTSW 2 70973389 missense possibly damaging 0.73
R7181:Mettl8 UTSW 2 70973362 missense possibly damaging 0.79
R7288:Mettl8 UTSW 2 70982038 missense probably benign 0.01
R7409:Mettl8 UTSW 2 70973343 missense probably damaging 1.00
R7498:Mettl8 UTSW 2 70965625 missense probably damaging 0.98
R7639:Mettl8 UTSW 2 70982182 missense probably benign
R7789:Mettl8 UTSW 2 70966462 missense probably damaging 1.00
R7795:Mettl8 UTSW 2 70981899 missense probably benign
X0062:Mettl8 UTSW 2 70981974 missense probably benign 0.33
Z1177:Mettl8 UTSW 2 70973338 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATGCTTCTGTGTGGCAC -3'
(R):5'- GCTCAGCTTCGTTTTAAGAAAGG -3'

Sequencing Primer
(F):5'- CACTATTGTGAGTACCGGGGC -3'
(R):5'- GATCTCTGAGTTCAAGGCTAGCC -3'
Posted On2018-05-04