Incidental Mutation 'R6402:Cdc14a'
ID516191
Institutional Source Beutler Lab
Gene Symbol Cdc14a
Ensembl Gene ENSMUSG00000033502
Gene NameCDC14 cell division cycle 14A
SynonymsCDC14A2, Cdc14, CDC14a1, A830059A17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.305) question?
Stock #R6402 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location116272553-116424032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116348459 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 172 (Y172H)
Ref Sequence ENSEMBL: ENSMUSP00000087950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090464] [ENSMUST00000106491] [ENSMUST00000197830]
Predicted Effect probably damaging
Transcript: ENSMUST00000090464
AA Change: Y172H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000087950
Gene: ENSMUSG00000033502
AA Change: Y172H

DomainStartEndE-ValueType
Pfam:DSPn 13 153 1.6e-66 PFAM
Pfam:Y_phosphatase 210 324 1.1e-7 PFAM
Pfam:DSPc 214 328 1.8e-14 PFAM
low complexity region 539 558 N/A INTRINSIC
low complexity region 573 595 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106491
AA Change: Y123H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102100
Gene: ENSMUSG00000033502
AA Change: Y123H

DomainStartEndE-ValueType
Pfam:DSPn 12 121 9.5e-44 PFAM
Pfam:Y_phosphatase 160 274 6.4e-8 PFAM
Pfam:DSPc 160 280 2.8e-14 PFAM
low complexity region 490 509 N/A INTRINSIC
low complexity region 524 546 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196669
Predicted Effect probably benign
Transcript: ENSMUST00000197830
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein tyrosine phosphatase family. It is highly similar to Saccharomyces cerevisiae Cdc14, a protein tyrosine phosphatase involved in the exit of cell mitosis and initiation of DNA replication, suggesting a role in cell cycle control. This protein has been shown to interact with, and dephosphorylate tumor suppressor protein p53, and is thought to regulate the function of p53. Alternative splicing of this gene results in several transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 T A 9: 104,098,945 I268F possibly damaging Het
Adck2 T C 6: 39,586,869 V514A possibly damaging Het
Catsper1 G T 19: 5,339,496 G480W probably damaging Het
Cbarp A G 10: 80,135,122 I247T probably benign Het
Creld2 C T 15: 88,823,141 R221C probably damaging Het
Dmac1 C T 4: 75,277,980 probably null Het
Epsti1 A G 14: 77,939,878 E166G probably damaging Het
Hus1 A G 11: 9,010,407 F64S probably damaging Het
Kansl1l T A 1: 66,762,193 H538L probably damaging Het
Map4k2 T C 19: 6,344,081 probably null Het
Mettl8 A T 2: 70,966,461 Y98* probably null Het
Naip6 G T 13: 100,300,718 H432Q probably benign Het
Sirt4 C T 5: 115,480,311 V235M probably damaging Het
Slc23a3 T C 1: 75,128,556 N456S probably damaging Het
Slc9a1 C A 4: 133,370,651 H36Q probably benign Het
Spink14 A G 18: 44,030,974 T70A probably damaging Het
Stambpl1 C A 19: 34,234,139 P200Q probably benign Het
Trio T A 15: 27,902,911 I155L probably benign Het
Ttc37 A G 13: 76,135,270 H827R probably benign Het
Vmn1r51 T C 6: 90,129,462 V120A probably benign Het
Wac A G 18: 7,901,585 S77G possibly damaging Het
Zeb2 G A 2: 44,996,975 T675I probably damaging Het
Other mutations in Cdc14a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Cdc14a APN 3 116294844 nonsense probably null
IGL01062:Cdc14a APN 3 116274712 splice site probably benign
IGL01584:Cdc14a APN 3 116392825 nonsense probably null
IGL03084:Cdc14a APN 3 116348452 critical splice donor site probably null
IGL03237:Cdc14a APN 3 116404626 intron probably benign
IGL03296:Cdc14a APN 3 116297158 missense probably benign 0.02
PIT4131001:Cdc14a UTSW 3 116328661 missense possibly damaging 0.66
R0707:Cdc14a UTSW 3 116293713 splice site probably benign
R0782:Cdc14a UTSW 3 116322136 missense probably damaging 1.00
R0835:Cdc14a UTSW 3 116328522 missense probably benign 0.12
R1363:Cdc14a UTSW 3 116293860 small deletion probably benign
R1507:Cdc14a UTSW 3 116293997 missense possibly damaging 0.47
R1545:Cdc14a UTSW 3 116293724 critical splice donor site probably null
R1795:Cdc14a UTSW 3 116298473 missense possibly damaging 0.81
R1797:Cdc14a UTSW 3 116322194 missense probably damaging 1.00
R1830:Cdc14a UTSW 3 116422647 nonsense probably null
R4229:Cdc14a UTSW 3 116293764 missense probably damaging 0.99
R4655:Cdc14a UTSW 3 116328487 missense probably damaging 1.00
R4769:Cdc14a UTSW 3 116294750 critical splice donor site probably null
R4870:Cdc14a UTSW 3 116423460 missense probably benign 0.30
R4980:Cdc14a UTSW 3 116392857 nonsense probably null
R6228:Cdc14a UTSW 3 116351213 missense probably damaging 1.00
R6248:Cdc14a UTSW 3 116308194 missense probably benign 0.01
R6749:Cdc14a UTSW 3 116297158 missense possibly damaging 0.68
R6852:Cdc14a UTSW 3 116328676 missense possibly damaging 0.94
R6996:Cdc14a UTSW 3 116328706 missense probably damaging 1.00
R7185:Cdc14a UTSW 3 116294027 missense probably benign
R7783:Cdc14a UTSW 3 116404587 missense probably damaging 1.00
R7896:Cdc14a UTSW 3 116294833 missense probably benign 0.00
R7979:Cdc14a UTSW 3 116294833 missense probably benign 0.00
R8049:Cdc14a UTSW 3 116293928 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GAACTGAGTGCGTGCAACTG -3'
(R):5'- AGTCTGAAGTTTTACATGGGCTTAG -3'

Sequencing Primer
(F):5'- AGTGCGTGCAACTGTACATC -3'
(R):5'- TACATGGGCTTAGTGGGACCC -3'
Posted On2018-05-04