Incidental Mutation 'R6402:Dmac1'
ID516192
Institutional Source Beutler Lab
Gene Symbol Dmac1
Ensembl Gene ENSMUSG00000028398
Gene Namedistal membrane arm assembly complex 1
Synonyms1700027K24Rik, Tmem261, 3110001D03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R6402 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location75277354-75278305 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 75277980 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030103]
Predicted Effect probably null
Transcript: ENSMUST00000030103
SMART Domains Protein: ENSMUSP00000030103
Gene: ENSMUSG00000028398

DomainStartEndE-ValueType
low complexity region 12 38 N/A INTRINSIC
Pfam:DUF4536 45 91 2.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083950
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 T A 9: 104,098,945 I268F possibly damaging Het
Adck2 T C 6: 39,586,869 V514A possibly damaging Het
Catsper1 G T 19: 5,339,496 G480W probably damaging Het
Cbarp A G 10: 80,135,122 I247T probably benign Het
Cdc14a A G 3: 116,348,459 Y172H probably damaging Het
Creld2 C T 15: 88,823,141 R221C probably damaging Het
Epsti1 A G 14: 77,939,878 E166G probably damaging Het
Hus1 A G 11: 9,010,407 F64S probably damaging Het
Kansl1l T A 1: 66,762,193 H538L probably damaging Het
Map4k2 T C 19: 6,344,081 probably null Het
Mettl8 A T 2: 70,966,461 Y98* probably null Het
Naip6 G T 13: 100,300,718 H432Q probably benign Het
Sirt4 C T 5: 115,480,311 V235M probably damaging Het
Slc23a3 T C 1: 75,128,556 N456S probably damaging Het
Slc9a1 C A 4: 133,370,651 H36Q probably benign Het
Spink14 A G 18: 44,030,974 T70A probably damaging Het
Stambpl1 C A 19: 34,234,139 P200Q probably benign Het
Trio T A 15: 27,902,911 I155L probably benign Het
Ttc37 A G 13: 76,135,270 H827R probably benign Het
Vmn1r51 T C 6: 90,129,462 V120A probably benign Het
Wac A G 18: 7,901,585 S77G possibly damaging Het
Zeb2 G A 2: 44,996,975 T675I probably damaging Het
Other mutations in Dmac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0054:Dmac1 UTSW 4 75278100 missense possibly damaging 0.91
R0054:Dmac1 UTSW 4 75278100 missense possibly damaging 0.91
R0501:Dmac1 UTSW 4 75278176 missense unknown
R2396:Dmac1 UTSW 4 75278221 missense unknown
R6010:Dmac1 UTSW 4 75278236 missense unknown
Predicted Primers PCR Primer
(F):5'- TTTGGGGTCTACCAGAACAACTAC -3'
(R):5'- AGTACCGAGTTTTCCGCTCC -3'

Sequencing Primer
(F):5'- GGTCTACCAGAACAACTACACCCC -3'
(R):5'- TGTTTCCACAGCGGTTCC -3'
Posted On2018-05-04