Incidental Mutation 'R6402:Sirt4'
ID516194
Institutional Source Beutler Lab
Gene Symbol Sirt4
Ensembl Gene ENSMUSG00000029524
Gene Namesirtuin 4
Synonyms4930596O17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6402 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location115478010-115484725 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 115480311 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 235 (V235M)
Ref Sequence ENSEMBL: ENSMUSP00000107698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112066] [ENSMUST00000112067]
Predicted Effect probably damaging
Transcript: ENSMUST00000112066
AA Change: V235M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107697
Gene: ENSMUSG00000029524
AA Change: V235M

DomainStartEndE-ValueType
Pfam:SIR2 59 264 1.2e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112067
AA Change: V235M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107698
Gene: ENSMUSG00000029524
AA Change: V235M

DomainStartEndE-ValueType
Pfam:SIR2 59 264 3.7e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154729
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class IV of the sirtuin family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and display no apparent phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 T A 9: 104,098,945 I268F possibly damaging Het
Adck2 T C 6: 39,586,869 V514A possibly damaging Het
Catsper1 G T 19: 5,339,496 G480W probably damaging Het
Cbarp A G 10: 80,135,122 I247T probably benign Het
Cdc14a A G 3: 116,348,459 Y172H probably damaging Het
Creld2 C T 15: 88,823,141 R221C probably damaging Het
Dmac1 C T 4: 75,277,980 probably null Het
Epsti1 A G 14: 77,939,878 E166G probably damaging Het
Hus1 A G 11: 9,010,407 F64S probably damaging Het
Kansl1l T A 1: 66,762,193 H538L probably damaging Het
Map4k2 T C 19: 6,344,081 probably null Het
Mettl8 A T 2: 70,966,461 Y98* probably null Het
Naip6 G T 13: 100,300,718 H432Q probably benign Het
Slc23a3 T C 1: 75,128,556 N456S probably damaging Het
Slc9a1 C A 4: 133,370,651 H36Q probably benign Het
Spink14 A G 18: 44,030,974 T70A probably damaging Het
Stambpl1 C A 19: 34,234,139 P200Q probably benign Het
Trio T A 15: 27,902,911 I155L probably benign Het
Ttc37 A G 13: 76,135,270 H827R probably benign Het
Vmn1r51 T C 6: 90,129,462 V120A probably benign Het
Wac A G 18: 7,901,585 S77G possibly damaging Het
Zeb2 G A 2: 44,996,975 T675I probably damaging Het
Other mutations in Sirt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Sirt4 APN 5 115479626 unclassified probably null
IGL02475:Sirt4 APN 5 115482996 missense probably benign 0.00
IGL03198:Sirt4 APN 5 115483002 missense probably benign
R0743:Sirt4 UTSW 5 115482955 missense probably benign 0.03
R2136:Sirt4 UTSW 5 115479701 missense probably benign 0.35
R3792:Sirt4 UTSW 5 115480292 missense probably benign 0.33
R3793:Sirt4 UTSW 5 115480292 missense probably benign 0.33
R4791:Sirt4 UTSW 5 115480314 missense possibly damaging 0.52
R4810:Sirt4 UTSW 5 115480449 missense probably damaging 0.99
R4818:Sirt4 UTSW 5 115479726 missense possibly damaging 0.92
R4983:Sirt4 UTSW 5 115482791 missense probably benign 0.06
R5726:Sirt4 UTSW 5 115479646 missense probably benign 0.00
R7238:Sirt4 UTSW 5 115482990 missense possibly damaging 0.76
R7799:Sirt4 UTSW 5 115479746 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CGGTTATAGTTCAACATGTACGC -3'
(R):5'- TAGAGTCCTGTGCCTGAACTGTG -3'

Sequencing Primer
(F):5'- GTACACTCGCACACACTCG -3'
(R):5'- CCTGAACTGTGGGGAGCAGAC -3'
Posted On2018-05-04