Incidental Mutation 'R6402:Adck2'
ID516195
Institutional Source Beutler Lab
Gene Symbol Adck2
Ensembl Gene ENSMUSG00000046947
Gene NameaarF domain containing kinase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6402 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location39573873-39588769 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39586869 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 514 (V514A)
Ref Sequence ENSEMBL: ENSMUSP00000050256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051249] [ENSMUST00000140364] [ENSMUST00000145788]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051249
AA Change: V514A

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000050256
Gene: ENSMUSG00000046947
AA Change: V514A

DomainStartEndE-ValueType
low complexity region 90 124 N/A INTRINSIC
low complexity region 502 518 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000126621
AA Change: V44A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128218
Predicted Effect possibly damaging
Transcript: ENSMUST00000140364
AA Change: V563A

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123563
Gene: ENSMUSG00000046947
AA Change: V563A

DomainStartEndE-ValueType
low complexity region 90 124 N/A INTRINSIC
Pfam:ABC1 289 380 5.4e-18 PFAM
low complexity region 551 567 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145788
SMART Domains Protein: ENSMUSP00000144149
Gene: ENSMUSG00000046947

DomainStartEndE-ValueType
Pfam:ABC1 1 67 4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149304
SMART Domains Protein: ENSMUSP00000121590
Gene: ENSMUSG00000046947

DomainStartEndE-ValueType
Pfam:ABC1 1 69 1.4e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 T A 9: 104,098,945 I268F possibly damaging Het
Catsper1 G T 19: 5,339,496 G480W probably damaging Het
Cbarp A G 10: 80,135,122 I247T probably benign Het
Cdc14a A G 3: 116,348,459 Y172H probably damaging Het
Creld2 C T 15: 88,823,141 R221C probably damaging Het
Dmac1 C T 4: 75,277,980 probably null Het
Epsti1 A G 14: 77,939,878 E166G probably damaging Het
Hus1 A G 11: 9,010,407 F64S probably damaging Het
Kansl1l T A 1: 66,762,193 H538L probably damaging Het
Map4k2 T C 19: 6,344,081 probably null Het
Mettl8 A T 2: 70,966,461 Y98* probably null Het
Naip6 G T 13: 100,300,718 H432Q probably benign Het
Sirt4 C T 5: 115,480,311 V235M probably damaging Het
Slc23a3 T C 1: 75,128,556 N456S probably damaging Het
Slc9a1 C A 4: 133,370,651 H36Q probably benign Het
Spink14 A G 18: 44,030,974 T70A probably damaging Het
Stambpl1 C A 19: 34,234,139 P200Q probably benign Het
Trio T A 15: 27,902,911 I155L probably benign Het
Ttc37 A G 13: 76,135,270 H827R probably benign Het
Vmn1r51 T C 6: 90,129,462 V120A probably benign Het
Wac A G 18: 7,901,585 S77G possibly damaging Het
Zeb2 G A 2: 44,996,975 T675I probably damaging Het
Other mutations in Adck2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Adck2 APN 6 39583920 missense probably benign 0.02
IGL02369:Adck2 APN 6 39574744 missense probably damaging 0.97
IGL02956:Adck2 APN 6 39576502 missense probably benign 0.11
R0240:Adck2 UTSW 6 39583818 missense probably benign 0.10
R0240:Adck2 UTSW 6 39583818 missense probably benign 0.10
R0241:Adck2 UTSW 6 39583818 missense probably benign 0.10
R0241:Adck2 UTSW 6 39583818 missense probably benign 0.10
R1107:Adck2 UTSW 6 39585785 missense possibly damaging 0.91
R1691:Adck2 UTSW 6 39574968 nonsense probably null
R2125:Adck2 UTSW 6 39575142 missense probably benign 0.00
R2206:Adck2 UTSW 6 39583839 missense probably damaging 1.00
R2422:Adck2 UTSW 6 39583998 missense possibly damaging 0.61
R4795:Adck2 UTSW 6 39576393 missense probably benign 0.02
R5556:Adck2 UTSW 6 39583935 missense probably benign 0.02
R6824:Adck2 UTSW 6 39575124 missense probably benign 0.00
R6927:Adck2 UTSW 6 39584064 critical splice donor site probably null
R7163:Adck2 UTSW 6 39583863 missense probably damaging 0.99
Z1177:Adck2 UTSW 6 39574088 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCATTTGTGACTTGAAACTTGAGG -3'
(R):5'- TCCTCAGACTTTGTTCTGAAGGG -3'

Sequencing Primer
(F):5'- GGATGGACCTCTATTGGTAAATTCC -3'
(R):5'- CTTTGTTCTGAAGGGATCACAAGCC -3'
Posted On2018-05-04