Incidental Mutation 'R6402:Vmn1r51'
ID516196
Institutional Source Beutler Lab
Gene Symbol Vmn1r51
Ensembl Gene ENSMUSG00000062818
Gene Namevomeronasal 1 receptor 51
SynonymsV1ra1, VN12, V1r1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6402 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location90122596-90132264 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90129462 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 120 (V120A)
Ref Sequence ENSEMBL: ENSMUSP00000154676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072859] [ENSMUST00000174204] [ENSMUST00000226542] [ENSMUST00000226977] [ENSMUST00000227109] [ENSMUST00000227766] [ENSMUST00000227876] [ENSMUST00000227911] [ENSMUST00000228880]
Predicted Effect probably benign
Transcript: ENSMUST00000072859
AA Change: V120A

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000072637
Gene: ENSMUSG00000062818
AA Change: V120A

DomainStartEndE-ValueType
transmembrane domain 41 63 N/A INTRINSIC
Pfam:V1R 64 328 1.5e-138 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174204
AA Change: V120A

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133870
Gene: ENSMUSG00000062818
AA Change: V120A

DomainStartEndE-ValueType
transmembrane domain 41 63 N/A INTRINSIC
Pfam:V1R 64 328 1.5e-138 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204789
Predicted Effect probably benign
Transcript: ENSMUST00000226542
AA Change: V120A

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000226977
AA Change: V120A

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000227109
AA Change: V120A

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227145
Predicted Effect probably benign
Transcript: ENSMUST00000227766
AA Change: V120A

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000227876
AA Change: V120A

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000227911
AA Change: V120A

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228590
Predicted Effect probably benign
Transcript: ENSMUST00000228880
AA Change: V120A

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes and heterozygotes for a null mutation exhibit axons that fail to converge on multiple discrete glomeruli, but rather, appear widely distributed throughout the glomerular layer of the accessory olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 T A 9: 104,098,945 I268F possibly damaging Het
Adck2 T C 6: 39,586,869 V514A possibly damaging Het
Catsper1 G T 19: 5,339,496 G480W probably damaging Het
Cbarp A G 10: 80,135,122 I247T probably benign Het
Cdc14a A G 3: 116,348,459 Y172H probably damaging Het
Creld2 C T 15: 88,823,141 R221C probably damaging Het
Dmac1 C T 4: 75,277,980 probably null Het
Epsti1 A G 14: 77,939,878 E166G probably damaging Het
Hus1 A G 11: 9,010,407 F64S probably damaging Het
Kansl1l T A 1: 66,762,193 H538L probably damaging Het
Map4k2 T C 19: 6,344,081 probably null Het
Mettl8 A T 2: 70,966,461 Y98* probably null Het
Naip6 G T 13: 100,300,718 H432Q probably benign Het
Sirt4 C T 5: 115,480,311 V235M probably damaging Het
Slc23a3 T C 1: 75,128,556 N456S probably damaging Het
Slc9a1 C A 4: 133,370,651 H36Q probably benign Het
Spink14 A G 18: 44,030,974 T70A probably damaging Het
Stambpl1 C A 19: 34,234,139 P200Q probably benign Het
Trio T A 15: 27,902,911 I155L probably benign Het
Ttc37 A G 13: 76,135,270 H827R probably benign Het
Wac A G 18: 7,901,585 S77G possibly damaging Het
Zeb2 G A 2: 44,996,975 T675I probably damaging Het
Other mutations in Vmn1r51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Vmn1r51 APN 6 90129404 missense probably benign 0.07
R3196:Vmn1r51 UTSW 6 90129516 missense probably damaging 1.00
R5611:Vmn1r51 UTSW 6 90129710 missense probably benign 0.04
R6979:Vmn1r51 UTSW 6 90129204 missense possibly damaging 0.61
R7035:Vmn1r51 UTSW 6 90129225 missense probably benign 0.00
R7074:Vmn1r51 UTSW 6 90129672 missense probably benign 0.01
R7676:Vmn1r51 UTSW 6 90129455 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TTGGCATTGGGATCTCAGGC -3'
(R):5'- GATGGATACCAAGAGTTGACTGC -3'

Sequencing Primer
(F):5'- CATTGGGATCTCAGGCAATAGCTTC -3'
(R):5'- TACCAAGAGTTGACTGCCAATTAAC -3'
Posted On2018-05-04