Incidental Mutation 'R6402:Ackr4'
ID516197
Institutional Source Beutler Lab
Gene Symbol Ackr4
Ensembl Gene ENSMUSG00000079355
Gene Nameatypical chemokine receptor 4
SynonymsPPR1, CCBP2, CCR11, VSHK1, A630091E18Rik, CCX-CKR, Ccrl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6402 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location104084157-104126933 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104098945 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 268 (I268F)
Ref Sequence ENSEMBL: ENSMUSP00000152036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047799] [ENSMUST00000076147] [ENSMUST00000120854] [ENSMUST00000188000] [ENSMUST00000189998] [ENSMUST00000219146]
Predicted Effect probably benign
Transcript: ENSMUST00000047799
SMART Domains Protein: ENSMUSP00000043424
Gene: ENSMUSG00000090150

DomainStartEndE-ValueType
Pfam:APH 43 307 3.5e-45 PFAM
Pfam:Acyl-CoA_dh_N 376 498 1.5e-13 PFAM
Pfam:Acyl-CoA_dh_M 502 605 1.7e-21 PFAM
Pfam:Acyl-CoA_dh_1 617 768 2.7e-36 PFAM
Pfam:Acyl-CoA_dh_2 632 743 2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000050139
SMART Domains Protein: ENSMUSP00000062941
Gene: ENSMUSG00000041748

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000076147
AA Change: I268F

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000075507
Gene: ENSMUSG00000079355
AA Change: I268F

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
Pfam:7tm_1 58 303 8.9e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120854
SMART Domains Protein: ENSMUSP00000112994
Gene: ENSMUSG00000090150

DomainStartEndE-ValueType
Pfam:APH 1 188 1.1e-28 PFAM
Pfam:EcKinase 49 143 4.8e-9 PFAM
Pfam:Acyl-CoA_dh_N 257 380 8.7e-15 PFAM
Pfam:Acyl-CoA_dh_M 385 439 2.4e-19 PFAM
Pfam:Acyl-CoA_dh_1 499 650 1.3e-37 PFAM
Pfam:Acyl-CoA_dh_2 514 632 2.7e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154431
Predicted Effect possibly damaging
Transcript: ENSMUST00000188000
AA Change: I268F

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140792
Gene: ENSMUSG00000079355
AA Change: I268F

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
Pfam:7tm_1 58 303 5.6e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214661
Predicted Effect possibly damaging
Transcript: ENSMUST00000219146
AA Change: I268F

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G protein-coupled receptor family, and is a receptor for C-C type chemokines. This receptor has been shown to bind dendritic cell- and T cell-activated chemokines including CCL19/ELC, CCL21/SLC, and CCL25/TECK. A pseudogene of this gene is found on chromosome 6. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a targeted null mutation do not exhibit any significant abnormalities compared to controls. Mice homozygous for a different knock-out allele exhibit increased susceptibility to experimental autoimmune encephalomyelitis with increased Th17 response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck2 T C 6: 39,586,869 V514A possibly damaging Het
Catsper1 G T 19: 5,339,496 G480W probably damaging Het
Cbarp A G 10: 80,135,122 I247T probably benign Het
Cdc14a A G 3: 116,348,459 Y172H probably damaging Het
Creld2 C T 15: 88,823,141 R221C probably damaging Het
Dmac1 C T 4: 75,277,980 probably null Het
Epsti1 A G 14: 77,939,878 E166G probably damaging Het
Hus1 A G 11: 9,010,407 F64S probably damaging Het
Kansl1l T A 1: 66,762,193 H538L probably damaging Het
Map4k2 T C 19: 6,344,081 probably null Het
Mettl8 A T 2: 70,966,461 Y98* probably null Het
Naip6 G T 13: 100,300,718 H432Q probably benign Het
Sirt4 C T 5: 115,480,311 V235M probably damaging Het
Slc23a3 T C 1: 75,128,556 N456S probably damaging Het
Slc9a1 C A 4: 133,370,651 H36Q probably benign Het
Spink14 A G 18: 44,030,974 T70A probably damaging Het
Stambpl1 C A 19: 34,234,139 P200Q probably benign Het
Trio T A 15: 27,902,911 I155L probably benign Het
Ttc37 A G 13: 76,135,270 H827R probably benign Het
Vmn1r51 T C 6: 90,129,462 V120A probably benign Het
Wac A G 18: 7,901,585 S77G possibly damaging Het
Zeb2 G A 2: 44,996,975 T675I probably damaging Het
Other mutations in Ackr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01593:Ackr4 APN 9 104085931 intron probably benign
IGL01859:Ackr4 APN 9 104086137 intron probably benign
IGL02088:Ackr4 APN 9 104098881 missense probably damaging 0.99
R0108:Ackr4 UTSW 9 104099188 missense probably benign 0.07
R0194:Ackr4 UTSW 9 104099480 missense probably benign 0.31
R0208:Ackr4 UTSW 9 104099661 missense probably benign
R0519:Ackr4 UTSW 9 104099451 missense probably benign 0.02
R0594:Ackr4 UTSW 9 104099004 missense possibly damaging 0.55
R0940:Ackr4 UTSW 9 104099632 missense probably damaging 1.00
R4510:Ackr4 UTSW 9 104098731 missense probably benign 0.02
R4511:Ackr4 UTSW 9 104098731 missense probably benign 0.02
R5298:Ackr4 UTSW 9 104098887 missense possibly damaging 0.91
R5961:Ackr4 UTSW 9 104099139 missense probably damaging 1.00
R6762:Ackr4 UTSW 9 104099668 missense probably benign 0.06
R7080:Ackr4 UTSW 9 104099562 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTGTAGGACCCTCAGAATC -3'
(R):5'- GGTCCCGTTTCTCATCATGG -3'

Sequencing Primer
(F):5'- TCTGTAGGACCCTCAGAATCAAAAGG -3'
(R):5'- CTCATCATGGGCGTGTGC -3'
Posted On2018-05-04