Incidental Mutation 'R6402:Cbarp'
ID516198
Institutional Source Beutler Lab
Gene Symbol Cbarp
Ensembl Gene ENSMUSG00000035640
Gene Namecalcium channel, voltage-dependent, beta subunit associated regulatory protein
SynonymsR29144/1, Dos
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6402 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location80130451-80140835 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80135122 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 247 (I247T)
Ref Sequence ENSEMBL: ENSMUSP00000131487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003152] [ENSMUST00000105369] [ENSMUST00000105370] [ENSMUST00000105371] [ENSMUST00000123967] [ENSMUST00000132523] [ENSMUST00000142853] [ENSMUST00000144883] [ENSMUST00000147778] [ENSMUST00000152592] [ENSMUST00000169546] [ENSMUST00000170219]
Predicted Effect probably benign
Transcript: ENSMUST00000003152
SMART Domains Protein: ENSMUSP00000003152
Gene: ENSMUSG00000003068

DomainStartEndE-ValueType
S_TKc 49 309 1.28e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105369
AA Change: I247T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101008
Gene: ENSMUSG00000035640
AA Change: I247T

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
transmembrane domain 41 63 N/A INTRINSIC
low complexity region 185 197 N/A INTRINSIC
low complexity region 269 277 N/A INTRINSIC
low complexity region 380 388 N/A INTRINSIC
low complexity region 402 420 N/A INTRINSIC
low complexity region 444 484 N/A INTRINSIC
low complexity region 515 534 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
low complexity region 627 651 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105370
SMART Domains Protein: ENSMUSP00000101009
Gene: ENSMUSG00000003068

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 180 2.8e-22 PFAM
Pfam:Pkinase 1 183 2.8e-40 PFAM
Pfam:Kinase-like 8 171 5.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105371
Predicted Effect probably benign
Transcript: ENSMUST00000123967
SMART Domains Protein: ENSMUSP00000125962
Gene: ENSMUSG00000035640

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 68 87 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132317
Predicted Effect probably benign
Transcript: ENSMUST00000132523
SMART Domains Protein: ENSMUSP00000128980
Gene: ENSMUSG00000035640

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
transmembrane domain 43 65 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138776
Predicted Effect probably benign
Transcript: ENSMUST00000142853
Predicted Effect probably benign
Transcript: ENSMUST00000144883
SMART Domains Protein: ENSMUSP00000114195
Gene: ENSMUSG00000003068

DomainStartEndE-ValueType
S_TKc 49 309 1.28e-80 SMART
low complexity region 396 411 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146180
Predicted Effect probably benign
Transcript: ENSMUST00000147778
SMART Domains Protein: ENSMUSP00000130389
Gene: ENSMUSG00000035640

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
transmembrane domain 43 65 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150347
Predicted Effect probably benign
Transcript: ENSMUST00000152592
SMART Domains Protein: ENSMUSP00000118853
Gene: ENSMUSG00000003068

DomainStartEndE-ValueType
Blast:S_TKc 1 53 6e-31 BLAST
PDB:2WTK|F 1 74 1e-40 PDB
SCOP:d1koba_ 1 89 1e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169546
AA Change: I254T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132978
Gene: ENSMUSG00000035640
AA Change: I254T

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
low complexity region 192 204 N/A INTRINSIC
low complexity region 276 284 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
low complexity region 409 427 N/A INTRINSIC
low complexity region 451 491 N/A INTRINSIC
low complexity region 522 541 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
low complexity region 634 658 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170219
AA Change: I247T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131487
Gene: ENSMUSG00000035640
AA Change: I247T

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
transmembrane domain 41 63 N/A INTRINSIC
low complexity region 185 197 N/A INTRINSIC
low complexity region 269 277 N/A INTRINSIC
low complexity region 380 388 N/A INTRINSIC
low complexity region 402 420 N/A INTRINSIC
low complexity region 444 484 N/A INTRINSIC
low complexity region 515 534 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
low complexity region 627 651 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 T A 9: 104,098,945 I268F possibly damaging Het
Adck2 T C 6: 39,586,869 V514A possibly damaging Het
Catsper1 G T 19: 5,339,496 G480W probably damaging Het
Cdc14a A G 3: 116,348,459 Y172H probably damaging Het
Creld2 C T 15: 88,823,141 R221C probably damaging Het
Dmac1 C T 4: 75,277,980 probably null Het
Epsti1 A G 14: 77,939,878 E166G probably damaging Het
Hus1 A G 11: 9,010,407 F64S probably damaging Het
Kansl1l T A 1: 66,762,193 H538L probably damaging Het
Map4k2 T C 19: 6,344,081 probably null Het
Mettl8 A T 2: 70,966,461 Y98* probably null Het
Naip6 G T 13: 100,300,718 H432Q probably benign Het
Sirt4 C T 5: 115,480,311 V235M probably damaging Het
Slc23a3 T C 1: 75,128,556 N456S probably damaging Het
Slc9a1 C A 4: 133,370,651 H36Q probably benign Het
Spink14 A G 18: 44,030,974 T70A probably damaging Het
Stambpl1 C A 19: 34,234,139 P200Q probably benign Het
Trio T A 15: 27,902,911 I155L probably benign Het
Ttc37 A G 13: 76,135,270 H827R probably benign Het
Vmn1r51 T C 6: 90,129,462 V120A probably benign Het
Wac A G 18: 7,901,585 S77G possibly damaging Het
Zeb2 G A 2: 44,996,975 T675I probably damaging Het
Other mutations in Cbarp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02516:Cbarp APN 10 80135545 missense probably damaging 1.00
R1181:Cbarp UTSW 10 80135494 missense probably damaging 1.00
R1189:Cbarp UTSW 10 80131796 missense possibly damaging 0.77
R2937:Cbarp UTSW 10 80131769 missense probably damaging 0.99
R2938:Cbarp UTSW 10 80131769 missense probably damaging 0.99
R3931:Cbarp UTSW 10 80135514 missense probably damaging 1.00
R4199:Cbarp UTSW 10 80135492 missense probably damaging 1.00
R4573:Cbarp UTSW 10 80131411 missense probably damaging 0.99
R5274:Cbarp UTSW 10 80131815 missense possibly damaging 0.57
R5761:Cbarp UTSW 10 80132233 unclassified probably benign
R6112:Cbarp UTSW 10 80135371 splice site probably null
R7087:Cbarp UTSW 10 80136408 missense probably damaging 1.00
R7270:Cbarp UTSW 10 80137317 missense possibly damaging 0.63
R7287:Cbarp UTSW 10 80137320 missense unknown
R7427:Cbarp UTSW 10 80131304 missense probably damaging 0.99
R7428:Cbarp UTSW 10 80131304 missense probably damaging 0.99
X0025:Cbarp UTSW 10 80131577 missense probably damaging 0.96
Z1177:Cbarp UTSW 10 80131872 missense probably damaging 0.99
Z1177:Cbarp UTSW 10 80133060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATCCTGCCTACAAGTTCTGTTC -3'
(R):5'- TTCAGCAGGTCTTGGAAGGC -3'

Sequencing Primer
(F):5'- ACAAGTTCTGTTCCTTGGGC -3'
(R):5'- GGATCGCCCCTCACCTAC -3'
Posted On2018-05-04