Incidental Mutation 'R6402:Epsti1'
ID516202
Institutional Source Beutler Lab
Gene Symbol Epsti1
Ensembl Gene ENSMUSG00000022014
Gene Nameepithelial stromal interaction 1 (breast)
Synonyms5033415K03Rik, 2310046K10Rik, BRESI1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6402 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location77904239-78002657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77939878 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 166 (E166G)
Ref Sequence ENSEMBL: ENSMUSP00000130138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022591] [ENSMUST00000169978] [ENSMUST00000227903]
Predicted Effect probably damaging
Transcript: ENSMUST00000022591
AA Change: E166G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022591
Gene: ENSMUSG00000022014
AA Change: E166G

DomainStartEndE-ValueType
coiled coil region 111 180 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169978
AA Change: E166G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130138
Gene: ENSMUSG00000022014
AA Change: E166G

DomainStartEndE-ValueType
coiled coil region 111 180 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000227903
AA Change: E166G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been shown to promote tumor invasion and metastasis in some invasive cancer cells when overexpressed. Expression of this gene has been shown to be upregulated by direct binding of the Kruppel like factor 8 protein to promoter sequences. The translated protein interacts with the amino terminal region of the valosin containing protein gene product, resulting in the nuclear translocation of the nuclear factor kappa B subunit 1 gene product, and activation of target genes. Overexpression of this gene has been observed in some breast cancers and in some individuals with systemic lupus erythematosus (SLE). [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 T A 9: 104,098,945 I268F possibly damaging Het
Adck2 T C 6: 39,586,869 V514A possibly damaging Het
Catsper1 G T 19: 5,339,496 G480W probably damaging Het
Cbarp A G 10: 80,135,122 I247T probably benign Het
Cdc14a A G 3: 116,348,459 Y172H probably damaging Het
Creld2 C T 15: 88,823,141 R221C probably damaging Het
Dmac1 C T 4: 75,277,980 probably null Het
Hus1 A G 11: 9,010,407 F64S probably damaging Het
Kansl1l T A 1: 66,762,193 H538L probably damaging Het
Map4k2 T C 19: 6,344,081 probably null Het
Mettl8 A T 2: 70,966,461 Y98* probably null Het
Naip6 G T 13: 100,300,718 H432Q probably benign Het
Sirt4 C T 5: 115,480,311 V235M probably damaging Het
Slc23a3 T C 1: 75,128,556 N456S probably damaging Het
Slc9a1 C A 4: 133,370,651 H36Q probably benign Het
Spink14 A G 18: 44,030,974 T70A probably damaging Het
Stambpl1 C A 19: 34,234,139 P200Q probably benign Het
Trio T A 15: 27,902,911 I155L probably benign Het
Ttc37 A G 13: 76,135,270 H827R probably benign Het
Vmn1r51 T C 6: 90,129,462 V120A probably benign Het
Wac A G 18: 7,901,585 S77G possibly damaging Het
Zeb2 G A 2: 44,996,975 T675I probably damaging Het
Other mutations in Epsti1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01787:Epsti1 APN 14 77972612 critical splice donor site probably null
IGL02749:Epsti1 APN 14 77939923 missense probably damaging 1.00
IGL03031:Epsti1 APN 14 77974581 missense probably benign 0.00
R0302:Epsti1 UTSW 14 77939926 missense probably damaging 0.97
R0605:Epsti1 UTSW 14 77927237 splice site probably benign
R0743:Epsti1 UTSW 14 77931275 missense probably damaging 1.00
R0884:Epsti1 UTSW 14 77931275 missense probably damaging 1.00
R1986:Epsti1 UTSW 14 77932233 critical splice donor site probably null
R3162:Epsti1 UTSW 14 77974513 splice site probably benign
R5118:Epsti1 UTSW 14 77986682 splice site probably null
R5296:Epsti1 UTSW 14 77904650 missense probably benign 0.03
R5392:Epsti1 UTSW 14 77986744 missense probably benign 0.00
R5664:Epsti1 UTSW 14 77963664 missense possibly damaging 0.73
R5948:Epsti1 UTSW 14 77939890 missense probably damaging 1.00
R7494:Epsti1 UTSW 14 77928754 missense probably benign 0.10
R7520:Epsti1 UTSW 14 77963443 intron probably null
R7671:Epsti1 UTSW 14 77904490 missense probably damaging 1.00
R8039:Epsti1 UTSW 14 77931301 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGGGCCGTCTATGTAGTAC -3'
(R):5'- GTAAGCGACCTGATCTCAGATTCC -3'

Sequencing Primer
(F):5'- GCCGTCTATGTAGTACTTCCGG -3'
(R):5'- CTGATCTCAGATTCCCAGAGATGG -3'
Posted On2018-05-04