Incidental Mutation 'R6402:Wac'
ID516205
Institutional Source Beutler Lab
Gene Symbol Wac
Ensembl Gene ENSMUSG00000024283
Gene NameWW domain containing adaptor with coiled-coil
Synonyms1110067P07Rik, A230035H12Rik, Wwp4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6402 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location7868832-7973547 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7901585 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 77 (S77G)
Ref Sequence ENSEMBL: ENSMUSP00000128321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074919] [ENSMUST00000092112] [ENSMUST00000166062] [ENSMUST00000167020] [ENSMUST00000168446] [ENSMUST00000169010] [ENSMUST00000170854] [ENSMUST00000171042] [ENSMUST00000171486] [ENSMUST00000172018]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074919
AA Change: S77G

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000074454
Gene: ENSMUSG00000024283
AA Change: S77G

DomainStartEndE-ValueType
low complexity region 55 77 N/A INTRINSIC
WW 85 117 2.12e-7 SMART
low complexity region 207 222 N/A INTRINSIC
low complexity region 287 307 N/A INTRINSIC
low complexity region 320 331 N/A INTRINSIC
low complexity region 466 481 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000092112
AA Change: S122G

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000089746
Gene: ENSMUSG00000024283
AA Change: S122G

DomainStartEndE-ValueType
low complexity region 100 122 N/A INTRINSIC
WW 130 162 2.12e-7 SMART
low complexity region 229 249 N/A INTRINSIC
low complexity region 262 273 N/A INTRINSIC
low complexity region 408 423 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000165854
AA Change: S41G
SMART Domains Protein: ENSMUSP00000126815
Gene: ENSMUSG00000024283
AA Change: S41G

DomainStartEndE-ValueType
low complexity region 20 42 N/A INTRINSIC
WW 50 82 2.12e-7 SMART
low complexity region 265 280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166062
AA Change: S77G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000132532
Gene: ENSMUSG00000024283
AA Change: S77G

DomainStartEndE-ValueType
low complexity region 55 77 N/A INTRINSIC
WW 85 117 2.12e-7 SMART
low complexity region 207 222 N/A INTRINSIC
low complexity region 287 307 N/A INTRINSIC
low complexity region 320 331 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167020
AA Change: S122G

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132117
Gene: ENSMUSG00000024283
AA Change: S122G

DomainStartEndE-ValueType
low complexity region 100 122 N/A INTRINSIC
WW 130 162 2.12e-7 SMART
low complexity region 252 267 N/A INTRINSIC
low complexity region 332 352 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 511 526 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168446
AA Change: S128G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000131032
Gene: ENSMUSG00000024283
AA Change: S128G

DomainStartEndE-ValueType
low complexity region 106 128 N/A INTRINSIC
WW 136 168 2.12e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169010
AA Change: S77G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131750
Gene: ENSMUSG00000024283
AA Change: S77G

DomainStartEndE-ValueType
low complexity region 55 77 N/A INTRINSIC
Pfam:WW 86 113 2.8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170854
SMART Domains Protein: ENSMUSP00000131141
Gene: ENSMUSG00000024283

DomainStartEndE-ValueType
low complexity region 100 115 N/A INTRINSIC
low complexity region 187 207 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171042
AA Change: S77G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133185
Gene: ENSMUSG00000024283
AA Change: S77G

DomainStartEndE-ValueType
low complexity region 55 77 N/A INTRINSIC
WW 85 117 2.12e-7 SMART
low complexity region 184 204 N/A INTRINSIC
low complexity region 217 228 N/A INTRINSIC
low complexity region 359 374 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171486
AA Change: S77G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000127848
Gene: ENSMUSG00000024283
AA Change: S77G

DomainStartEndE-ValueType
low complexity region 55 77 N/A INTRINSIC
WW 85 117 2.12e-7 SMART
low complexity region 184 204 N/A INTRINSIC
low complexity region 217 228 N/A INTRINSIC
low complexity region 360 375 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172018
AA Change: S77G

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128321
Gene: ENSMUSG00000024283
AA Change: S77G

DomainStartEndE-ValueType
low complexity region 55 77 N/A INTRINSIC
WW 85 117 2.12e-7 SMART
low complexity region 207 222 N/A INTRINSIC
low complexity region 287 307 N/A INTRINSIC
low complexity region 320 331 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a WW domain, which is a protein module found in a wide range of signaling proteins. This domain mediates protein-protein interactions and binds proteins containing short linear peptide motifs that are proline-rich or contain at least one proline. This gene product shares 94% sequence identity with the WAC protein in mouse, however, its exact function is not known. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 T A 9: 104,098,945 I268F possibly damaging Het
Adck2 T C 6: 39,586,869 V514A possibly damaging Het
Catsper1 G T 19: 5,339,496 G480W probably damaging Het
Cbarp A G 10: 80,135,122 I247T probably benign Het
Cdc14a A G 3: 116,348,459 Y172H probably damaging Het
Creld2 C T 15: 88,823,141 R221C probably damaging Het
Dmac1 C T 4: 75,277,980 probably null Het
Epsti1 A G 14: 77,939,878 E166G probably damaging Het
Hus1 A G 11: 9,010,407 F64S probably damaging Het
Kansl1l T A 1: 66,762,193 H538L probably damaging Het
Map4k2 T C 19: 6,344,081 probably null Het
Mettl8 A T 2: 70,966,461 Y98* probably null Het
Naip6 G T 13: 100,300,718 H432Q probably benign Het
Sirt4 C T 5: 115,480,311 V235M probably damaging Het
Slc23a3 T C 1: 75,128,556 N456S probably damaging Het
Slc9a1 C A 4: 133,370,651 H36Q probably benign Het
Spink14 A G 18: 44,030,974 T70A probably damaging Het
Stambpl1 C A 19: 34,234,139 P200Q probably benign Het
Trio T A 15: 27,902,911 I155L probably benign Het
Ttc37 A G 13: 76,135,270 H827R probably benign Het
Vmn1r51 T C 6: 90,129,462 V120A probably benign Het
Zeb2 G A 2: 44,996,975 T675I probably damaging Het
Other mutations in Wac
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02404:Wac APN 18 7917570 missense probably damaging 1.00
R1077:Wac UTSW 18 7921916 missense probably damaging 1.00
R2915:Wac UTSW 18 7926131 missense possibly damaging 0.96
R3196:Wac UTSW 18 7917568 missense probably damaging 1.00
R3793:Wac UTSW 18 7920190 missense possibly damaging 0.86
R3840:Wac UTSW 18 7918535 missense probably damaging 1.00
R3971:Wac UTSW 18 7916175 missense probably damaging 1.00
R6429:Wac UTSW 18 7920163 missense probably damaging 0.97
R6536:Wac UTSW 18 7905189 unclassified probably null
R6615:Wac UTSW 18 7868884 unclassified probably null
R6645:Wac UTSW 18 7973523 missense probably damaging 1.00
R7088:Wac UTSW 18 7921455 missense probably damaging 0.99
R7464:Wac UTSW 18 7871746 critical splice donor site probably null
R7760:Wac UTSW 18 7921913 missense probably benign 0.43
X0066:Wac UTSW 18 7916298 critical splice donor site probably null
Z1176:Wac UTSW 18 7973531 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGTTTTACAGTGGCATGC -3'
(R):5'- TTGTCCTCACTGTCTAACAAAGTAC -3'

Sequencing Primer
(F):5'- AAGGGACCAGTTACTCTC -3'
(R):5'- TGTCTAACAAAGTACAAAGCACAGAG -3'
Posted On2018-05-04