Incidental Mutation 'R6402:Spink14'
ID516206
Institutional Source Beutler Lab
Gene Symbol Spink14
Ensembl Gene ENSMUSG00000051050
Gene Nameserine peptidase inhibitor, Kazal type 14
SynonymsGm5505
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6402 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location44027869-44032208 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44030974 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 70 (T70A)
Ref Sequence ENSEMBL: ENSMUSP00000125319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060328] [ENSMUST00000162265]
Predicted Effect probably damaging
Transcript: ENSMUST00000060328
AA Change: T70A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057781
Gene: ENSMUSG00000051050
AA Change: T70A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KAZAL 38 96 1.98e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162265
AA Change: T70A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125319
Gene: ENSMUSG00000051050
AA Change: T70A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KAZAL 38 96 1.98e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 T A 9: 104,098,945 I268F possibly damaging Het
Adck2 T C 6: 39,586,869 V514A possibly damaging Het
Catsper1 G T 19: 5,339,496 G480W probably damaging Het
Cbarp A G 10: 80,135,122 I247T probably benign Het
Cdc14a A G 3: 116,348,459 Y172H probably damaging Het
Creld2 C T 15: 88,823,141 R221C probably damaging Het
Dmac1 C T 4: 75,277,980 probably null Het
Epsti1 A G 14: 77,939,878 E166G probably damaging Het
Hus1 A G 11: 9,010,407 F64S probably damaging Het
Kansl1l T A 1: 66,762,193 H538L probably damaging Het
Map4k2 T C 19: 6,344,081 probably null Het
Mettl8 A T 2: 70,966,461 Y98* probably null Het
Naip6 G T 13: 100,300,718 H432Q probably benign Het
Sirt4 C T 5: 115,480,311 V235M probably damaging Het
Slc23a3 T C 1: 75,128,556 N456S probably damaging Het
Slc9a1 C A 4: 133,370,651 H36Q probably benign Het
Stambpl1 C A 19: 34,234,139 P200Q probably benign Het
Trio T A 15: 27,902,911 I155L probably benign Het
Ttc37 A G 13: 76,135,270 H827R probably benign Het
Vmn1r51 T C 6: 90,129,462 V120A probably benign Het
Wac A G 18: 7,901,585 S77G possibly damaging Het
Zeb2 G A 2: 44,996,975 T675I probably damaging Het
Other mutations in Spink14
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0066:Spink14 UTSW 18 44028763 missense probably benign
R0419:Spink14 UTSW 18 44031867 missense probably damaging 1.00
R1404:Spink14 UTSW 18 44028829 splice site probably benign
R2863:Spink14 UTSW 18 44030881 missense probably damaging 1.00
R6175:Spink14 UTSW 18 44031871 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ACAATCCACAAGAGGCCTATTG -3'
(R):5'- CTAACATGGCTACCTTAGATGCC -3'

Sequencing Primer
(F):5'- CCACAAGAGGCCTATTGTTTGAGC -3'
(R):5'- GGCTACCTTAGATGCCTGTAGAAC -3'
Posted On2018-05-04