Incidental Mutation 'R6403:Rprd2'
ID 516214
Institutional Source Beutler Lab
Gene Symbol Rprd2
Ensembl Gene ENSMUSG00000028106
Gene Name regulation of nuclear pre-mRNA domain containing 2
Synonyms 6720469I21Rik, 2810036A19Rik, 4930535B03Rik
MMRRC Submission 044382-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.742) question?
Stock # R6403 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 95760341-95818863 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 95766087 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 668 (C668F)
Ref Sequence ENSEMBL: ENSMUSP00000088297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090791]
AlphaFold Q6NXI6
Predicted Effect possibly damaging
Transcript: ENSMUST00000090791
AA Change: C668F

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000088297
Gene: ENSMUSG00000028106
AA Change: C668F

DomainStartEndE-ValueType
RPR 26 146 3.6e-29 SMART
Pfam:CREPT 210 351 9.3e-11 PFAM
low complexity region 431 465 N/A INTRINSIC
low complexity region 576 591 N/A INTRINSIC
low complexity region 612 633 N/A INTRINSIC
low complexity region 670 686 N/A INTRINSIC
low complexity region 777 793 N/A INTRINSIC
low complexity region 1159 1179 N/A INTRINSIC
low complexity region 1195 1208 N/A INTRINSIC
low complexity region 1230 1238 N/A INTRINSIC
low complexity region 1272 1295 N/A INTRINSIC
low complexity region 1300 1323 N/A INTRINSIC
low complexity region 1373 1409 N/A INTRINSIC
low complexity region 1446 1467 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198740
Predicted Effect unknown
Transcript: ENSMUST00000200164
AA Change: C584F
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars A G 8: 111,042,249 D227G possibly damaging Het
Aox1 A G 1: 58,068,435 I623V probably damaging Het
Camsap2 G A 1: 136,280,800 R317* probably null Het
Carmil1 G A 13: 24,081,967 R271C probably damaging Het
Ces2b T A 8: 104,836,269 L323* probably null Het
Copb1 T A 7: 114,238,451 I286F probably damaging Het
Dnajb11 T A 16: 22,870,941 V285D probably damaging Het
Dok5 G T 2: 170,829,900 A79S probably damaging Het
Enpp2 T C 15: 54,863,764 N557S probably damaging Het
Gm13088 G A 4: 143,655,773 Q118* probably null Het
Hexa G A 9: 59,557,361 R178H probably damaging Het
Iars T C 13: 49,687,495 S35P probably damaging Het
Il3ra G T 14: 14,347,137 A3S probably damaging Het
Iqcm T C 8: 75,577,996 probably null Het
Krt9 G T 11: 100,189,659 S420R probably damaging Het
Lca5l T C 16: 96,173,845 N293S probably benign Het
Mb21d2 A G 16: 28,828,517 I235T possibly damaging Het
Ncbp3 A G 11: 73,078,976 T550A probably benign Het
Nckipsd G T 9: 108,811,683 R139L possibly damaging Het
Nxn A G 11: 76,399,020 V14A probably benign Het
Olfr926 T C 9: 38,877,242 L22P probably damaging Het
Tmem87a A T 2: 120,380,771 M231K possibly damaging Het
Trappc8 A G 18: 20,866,071 V333A probably benign Het
Trit1 C A 4: 123,039,579 T103K possibly damaging Het
Tspan13 A G 12: 36,015,705 F203S probably damaging Het
Vmn2r114 C T 17: 23,309,965 D388N probably damaging Het
Zfp617 C T 8: 71,929,171 A55V probably benign Het
Other mutations in Rprd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Rprd2 APN 3 95765379 missense possibly damaging 0.95
IGL00773:Rprd2 APN 3 95765109 missense probably damaging 1.00
IGL00792:Rprd2 APN 3 95785104 missense probably benign 0.05
IGL01022:Rprd2 APN 3 95763754 nonsense probably null
IGL01121:Rprd2 APN 3 95776550 missense probably damaging 1.00
IGL01299:Rprd2 APN 3 95776547 missense probably damaging 1.00
IGL01387:Rprd2 APN 3 95765319 missense probably benign
IGL01414:Rprd2 APN 3 95765525 missense probably damaging 1.00
IGL02283:Rprd2 APN 3 95765503 missense probably damaging 0.98
IGL02336:Rprd2 APN 3 95787310 missense probably benign 0.17
R0131:Rprd2 UTSW 3 95774361 missense probably damaging 1.00
R0131:Rprd2 UTSW 3 95774361 missense probably damaging 1.00
R0132:Rprd2 UTSW 3 95774361 missense probably damaging 1.00
R0574:Rprd2 UTSW 3 95774357 missense possibly damaging 0.58
R0718:Rprd2 UTSW 3 95766387 missense probably benign 0.30
R0847:Rprd2 UTSW 3 95765413 missense probably benign 0.00
R0942:Rprd2 UTSW 3 95765418 missense probably damaging 1.00
R0943:Rprd2 UTSW 3 95784247 missense possibly damaging 0.88
R0980:Rprd2 UTSW 3 95765904 missense probably damaging 1.00
R1448:Rprd2 UTSW 3 95818576 missense possibly damaging 0.57
R1542:Rprd2 UTSW 3 95765676 missense possibly damaging 0.69
R1577:Rprd2 UTSW 3 95764735 missense probably damaging 1.00
R1598:Rprd2 UTSW 3 95818739 unclassified probably benign
R1640:Rprd2 UTSW 3 95763747 unclassified probably benign
R1670:Rprd2 UTSW 3 95764803 missense probably damaging 1.00
R2430:Rprd2 UTSW 3 95764795 nonsense probably null
R2966:Rprd2 UTSW 3 95766433 splice site probably null
R3612:Rprd2 UTSW 3 95764152 missense probably damaging 0.98
R3712:Rprd2 UTSW 3 95764560 missense probably damaging 0.97
R3890:Rprd2 UTSW 3 95765224 missense probably damaging 1.00
R4777:Rprd2 UTSW 3 95787374 missense probably benign 0.41
R4783:Rprd2 UTSW 3 95774333 missense probably benign 0.03
R4832:Rprd2 UTSW 3 95774171 missense probably damaging 1.00
R4928:Rprd2 UTSW 3 95764537 missense probably damaging 1.00
R4976:Rprd2 UTSW 3 95766349 missense probably damaging 1.00
R4989:Rprd2 UTSW 3 95765320 missense probably benign 0.03
R5134:Rprd2 UTSW 3 95765320 missense probably benign 0.03
R5244:Rprd2 UTSW 3 95790182 missense possibly damaging 0.80
R5314:Rprd2 UTSW 3 95764089 missense possibly damaging 0.53
R5579:Rprd2 UTSW 3 95785059 missense probably damaging 1.00
R5954:Rprd2 UTSW 3 95764863 missense probably damaging 1.00
R6016:Rprd2 UTSW 3 95787373 missense probably damaging 0.97
R6332:Rprd2 UTSW 3 95780441 missense probably damaging 0.99
R6415:Rprd2 UTSW 3 95774219 missense probably benign 0.00
R7064:Rprd2 UTSW 3 95765016 missense probably damaging 1.00
R7313:Rprd2 UTSW 3 95776710 missense probably damaging 1.00
R7496:Rprd2 UTSW 3 95765775 missense probably damaging 1.00
R7535:Rprd2 UTSW 3 95776587 missense probably damaging 0.96
R8716:Rprd2 UTSW 3 95776793 missense probably damaging 1.00
R8822:Rprd2 UTSW 3 95784301 missense probably damaging 1.00
R8891:Rprd2 UTSW 3 95764055 missense possibly damaging 0.85
R8922:Rprd2 UTSW 3 95780584 missense probably damaging 0.99
R9030:Rprd2 UTSW 3 95784310 missense probably benign 0.15
R9623:Rprd2 UTSW 3 95772193 missense probably benign 0.30
RF034:Rprd2 UTSW 3 95766320 small deletion probably benign
RF056:Rprd2 UTSW 3 95766319 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AAGTGCTAGTAGGACCACGC -3'
(R):5'- GTACCCAGTCTTTTATTCCCAAAAG -3'

Sequencing Primer
(F):5'- CTAGTAGGACCACGCTGGAAGTC -3'
(R):5'- ATTCCCAAAAGCTTCAACTATTCTC -3'
Posted On 2018-05-04