Incidental Mutation 'R6403:Iqcm'
ID516219
Institutional Source Beutler Lab
Gene Symbol Iqcm
Ensembl Gene ENSMUSG00000031620
Gene NameIQ motif containing M
Synonyms1700007B14Rik
MMRRC Submission 044382-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6403 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location75448694-75984503 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 75577996 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034033] [ENSMUST00000121983] [ENSMUST00000212704]
Predicted Effect probably null
Transcript: ENSMUST00000034033
SMART Domains Protein: ENSMUSP00000034033
Gene: ENSMUSG00000031620

DomainStartEndE-ValueType
IQ 281 303 2.54e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121983
SMART Domains Protein: ENSMUSP00000112901
Gene: ENSMUSG00000031620

DomainStartEndE-ValueType
IQ 281 303 2.54e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000212704
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars A G 8: 111,042,249 D227G possibly damaging Het
Aox1 A G 1: 58,068,435 I623V probably damaging Het
Camsap2 G A 1: 136,280,800 R317* probably null Het
Carmil1 G A 13: 24,081,967 R271C probably damaging Het
Ces2b T A 8: 104,836,269 L323* probably null Het
Copb1 T A 7: 114,238,451 I286F probably damaging Het
Dnajb11 T A 16: 22,870,941 V285D probably damaging Het
Dok5 G T 2: 170,829,900 A79S probably damaging Het
Enpp2 T C 15: 54,863,764 N557S probably damaging Het
Gm13088 G A 4: 143,655,773 Q118* probably null Het
Hexa G A 9: 59,557,361 R178H probably damaging Het
Iars T C 13: 49,687,495 S35P probably damaging Het
Il3ra G T 14: 14,347,137 A3S probably damaging Het
Krt9 G T 11: 100,189,659 S420R probably damaging Het
Lca5l T C 16: 96,173,845 N293S probably benign Het
Mb21d2 A G 16: 28,828,517 I235T possibly damaging Het
Ncbp3 A G 11: 73,078,976 T550A probably benign Het
Nckipsd G T 9: 108,811,683 R139L possibly damaging Het
Nxn A G 11: 76,399,020 V14A probably benign Het
Olfr926 T C 9: 38,877,242 L22P probably damaging Het
Rprd2 C A 3: 95,766,087 C668F possibly damaging Het
Tmem87a A T 2: 120,380,771 M231K possibly damaging Het
Trappc8 A G 18: 20,866,071 V333A probably benign Het
Trit1 C A 4: 123,039,579 T103K possibly damaging Het
Tspan13 A G 12: 36,015,705 F203S probably damaging Het
Vmn2r114 C T 17: 23,309,965 D388N probably damaging Het
Zfp617 C T 8: 71,929,171 A55V probably benign Het
Other mutations in Iqcm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01895:Iqcm APN 8 75888560 missense probably damaging 1.00
IGL02835:Iqcm APN 8 75554883 utr 5 prime probably benign
R0056:Iqcm UTSW 8 75753386 missense probably benign
R2146:Iqcm UTSW 8 75888613 missense probably damaging 1.00
R2910:Iqcm UTSW 8 75714776 missense probably benign
R3801:Iqcm UTSW 8 75669393 missense possibly damaging 0.59
R3804:Iqcm UTSW 8 75669393 missense possibly damaging 0.59
R3834:Iqcm UTSW 8 75577752 missense possibly damaging 0.93
R3897:Iqcm UTSW 8 75753400 missense probably damaging 1.00
R4447:Iqcm UTSW 8 75629766 missense probably damaging 0.97
R4448:Iqcm UTSW 8 75629766 missense probably damaging 0.97
R4450:Iqcm UTSW 8 75629766 missense probably damaging 0.97
R4687:Iqcm UTSW 8 75762989 missense probably damaging 1.00
R4810:Iqcm UTSW 8 75888653 missense probably damaging 1.00
R4845:Iqcm UTSW 8 75746352 missense probably damaging 0.99
R4856:Iqcm UTSW 8 75888600 missense possibly damaging 0.95
R4886:Iqcm UTSW 8 75888600 missense possibly damaging 0.95
R5063:Iqcm UTSW 8 75746286 missense probably damaging 1.00
R5460:Iqcm UTSW 8 75714789 missense probably benign
R6667:Iqcm UTSW 8 75753352 missense probably damaging 1.00
R7187:Iqcm UTSW 8 75753416 missense probably benign 0.22
R7263:Iqcm UTSW 8 75763073 missense probably benign
R7701:Iqcm UTSW 8 75554911 missense probably benign 0.02
R7916:Iqcm UTSW 8 75577950 missense probably benign
R7938:Iqcm UTSW 8 75577968 missense probably benign
R7974:Iqcm UTSW 8 75554892 start codon destroyed probably null 0.66
R8039:Iqcm UTSW 8 75763105 missense probably damaging 1.00
RF002:Iqcm UTSW 8 75577899 missense probably benign 0.01
X0018:Iqcm UTSW 8 75984212 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTGTCAAGTTCATACCTTTTGAGG -3'
(R):5'- ACACAACAGCCAGTTCTGG -3'

Sequencing Primer
(F):5'- TCAAGTTCATACCTTTTGAGGTTAAG -3'
(R):5'- AGAATGCTCTCATCACAGTTTCTGG -3'
Posted On2018-05-04