Incidental Mutation 'R6405:Asnsd1'
ID516239
Institutional Source Beutler Lab
Gene Symbol Asnsd1
Ensembl Gene ENSMUSG00000026095
Gene Nameasparagine synthetase domain containing 1
Synonyms2210409M21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R6405 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location53344617-53352752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53347995 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 158 (S158T)
Ref Sequence ENSEMBL: ENSMUSP00000139404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027264] [ENSMUST00000123519] [ENSMUST00000144660] [ENSMUST00000147021] [ENSMUST00000154402]
Predicted Effect probably damaging
Transcript: ENSMUST00000027264
AA Change: S158T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027264
Gene: ENSMUSG00000026095
AA Change: S158T

DomainStartEndE-ValueType
Pfam:GATase_7 59 162 2.4e-8 PFAM
Pfam:Asn_synthase 305 388 6.9e-7 PFAM
Pfam:Asn_synthase 505 619 2.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123519
SMART Domains Protein: ENSMUSP00000139025
Gene: ENSMUSG00000026095

DomainStartEndE-ValueType
Pfam:Asn_synthase 2 120 4.5e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136468
Predicted Effect probably damaging
Transcript: ENSMUST00000144660
AA Change: S158T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139404
Gene: ENSMUSG00000099913
AA Change: S158T

DomainStartEndE-ValueType
Pfam:GATase_7 59 162 1.4e-8 PFAM
Pfam:Asn_synthase 304 565 5.6e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147021
Predicted Effect probably benign
Transcript: ENSMUST00000154402
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,851,878 V769A probably damaging Het
Abca4 A G 3: 122,173,662 probably null Het
Ahnak2 A T 12: 112,773,337 S628T probably damaging Het
Ano8 T C 8: 71,483,030 T315A probably damaging Het
Arhgap32 T A 9: 32,248,488 V267E probably benign Het
Asxl2 T A 12: 3,493,758 V309E probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ccdc110 T A 8: 45,941,697 Y208* probably null Het
Cfap157 G T 2: 32,781,396 Q133K probably damaging Het
Cfap53 A G 18: 74,359,606 E467G probably damaging Het
Csmd3 T C 15: 47,820,371 I1688M probably damaging Het
Cyp3a11 A T 5: 145,862,420 L319Q probably damaging Het
Dchs2 A G 3: 83,354,263 I2613V probably benign Het
Dhx35 T A 2: 158,794,919 W11R probably damaging Het
Dscam C T 16: 96,678,425 G1174D probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Greb1l T A 18: 10,501,076 I402K probably benign Het
Hectd3 A T 4: 117,000,624 M585L probably benign Het
Inpp5k T C 11: 75,633,178 probably null Het
Lalba T G 15: 98,480,751 probably null Het
Lgals9 C A 11: 78,971,385 V125L probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Olfr117 A G 17: 37,660,123 I70T possibly damaging Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Rab4b T A 7: 27,172,954 D94V probably damaging Het
Rhpn2 A G 7: 35,372,439 E243G probably benign Het
Rp1 T C 1: 4,345,771 D1706G probably damaging Het
Slc29a3 A T 10: 60,716,026 I413N probably damaging Het
Slc7a9 T C 7: 35,454,639 L229P probably damaging Het
Tenm2 T C 11: 36,864,859 H104R probably benign Het
Tmem87a A G 2: 120,379,750 Y241H probably damaging Het
Trpv5 G T 6: 41,674,668 T192K probably damaging Het
Unc79 T C 12: 103,168,336 V2189A probably damaging Het
Vmn2r106 A C 17: 20,279,099 S183R probably benign Het
Vmn2r112 G T 17: 22,618,235 C559F probably damaging Het
Wdhd1 T C 14: 47,243,867 D1031G possibly damaging Het
Wnt5b T C 6: 119,433,496 S328G probably benign Het
Zcchc7 T C 4: 44,926,032 Y344H probably damaging Het
Other mutations in Asnsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Asnsd1 APN 1 53346628 missense probably damaging 1.00
IGL00595:Asnsd1 APN 1 53347488 missense probably damaging 1.00
IGL00705:Asnsd1 APN 1 53348451 missense probably damaging 1.00
IGL01089:Asnsd1 APN 1 53348277 missense probably damaging 1.00
IGL01747:Asnsd1 APN 1 53348095 nonsense probably null
IGL02274:Asnsd1 APN 1 53347575 missense probably benign
R2021:Asnsd1 UTSW 1 53347227 missense possibly damaging 0.53
R2022:Asnsd1 UTSW 1 53347227 missense possibly damaging 0.53
R2126:Asnsd1 UTSW 1 53347317 missense probably benign 0.00
R2174:Asnsd1 UTSW 1 53347601 missense probably benign 0.44
R4120:Asnsd1 UTSW 1 53347995 missense probably damaging 1.00
R4435:Asnsd1 UTSW 1 53348073 splice site probably null
R4464:Asnsd1 UTSW 1 53352527 splice site probably null
R4499:Asnsd1 UTSW 1 53347970 missense probably benign
R4622:Asnsd1 UTSW 1 53348219 missense probably benign 0.13
R5090:Asnsd1 UTSW 1 53352404 unclassified probably benign
R5832:Asnsd1 UTSW 1 53347475 missense probably damaging 1.00
R5891:Asnsd1 UTSW 1 53347977 missense probably benign 0.00
R6215:Asnsd1 UTSW 1 53348028 splice site probably null
R6217:Asnsd1 UTSW 1 53348028 missense probably benign 0.02
R6353:Asnsd1 UTSW 1 53347779 missense probably benign
R6913:Asnsd1 UTSW 1 53348231 missense probably damaging 0.99
R7217:Asnsd1 UTSW 1 53348193 missense probably damaging 1.00
R7570:Asnsd1 UTSW 1 53348258 missense probably damaging 1.00
R7589:Asnsd1 UTSW 1 53347967 missense probably benign 0.00
R7716:Asnsd1 UTSW 1 53347743 missense probably benign 0.05
R8314:Asnsd1 UTSW 1 53346655 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AATCCTGCTGGAGTCTGAGTC -3'
(R):5'- GATAATGACACCCAGGTTATGTTC -3'

Sequencing Primer
(F):5'- CTGGAGTCTGAGTCAGGTCATTAC -3'
(R):5'- GACACCCAGGTTATGTTCAATAGC -3'
Posted On2018-05-04