Incidental Mutation 'R6405:Bhlhe40'
ID 516251
Institutional Source Beutler Lab
Gene Symbol Bhlhe40
Ensembl Gene ENSMUSG00000030103
Gene Name basic helix-loop-helix family, member e40
Synonyms C130042M06Rik, Clast5, DEC1, CR8, Stra14, cytokine response gene 8, Sharp2, eip1 (E47 interaction protein 1), Bhlhb2, Stra13
MMRRC Submission 044550-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6405 (G1)
Quality Score 217.468
Status Not validated
Chromosome 6
Chromosomal Location 108637590-108643886 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) TG to TGG at 108641818 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change at position 254 (254)
Ref Sequence ENSEMBL: ENSMUSP00000032194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032194] [ENSMUST00000163617]
AlphaFold O35185
Predicted Effect probably null
Transcript: ENSMUST00000032194
AA Change: 254
SMART Domains Protein: ENSMUSP00000032194
Gene: ENSMUSG00000030103
AA Change: 254

DomainStartEndE-ValueType
HLH 58 113 2.52e-11 SMART
ORANGE 140 184 5.91e-13 SMART
low complexity region 230 248 N/A INTRINSIC
low complexity region 372 399 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137478
Predicted Effect probably benign
Transcript: ENSMUST00000163617
SMART Domains Protein: ENSMUSP00000132157
Gene: ENSMUSG00000030103

DomainStartEndE-ValueType
HLH 58 113 2.52e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204550
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a basic helix-loop-helix protein expressed in various tissues. The encoded protein can interact with Arntl or compete for E-box binding sites in the promoter of Per1 and repress Clock/Arntl's transactivation of Per1. This gene is believed to be involved in the control of circadian rhythm and cell differentiation. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in impaired immune function and hyperplasia of the lymphoid organs. Aging mutant animals exhibit autoimmune disease. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,669,742 (GRCm39) V769A probably damaging Het
Abca4 A G 3: 121,967,311 (GRCm39) probably null Het
Ahnak2 A T 12: 112,739,771 (GRCm39) S628T probably damaging Het
Ano8 T C 8: 71,935,674 (GRCm39) T315A probably damaging Het
Arhgap32 T A 9: 32,159,784 (GRCm39) V267E probably benign Het
Asnsd1 A T 1: 53,387,154 (GRCm39) S158T probably damaging Het
Asxl2 T A 12: 3,543,758 (GRCm39) V309E probably damaging Het
Ccdc110 T A 8: 46,394,734 (GRCm39) Y208* probably null Het
Cfap157 G T 2: 32,671,408 (GRCm39) Q133K probably damaging Het
Cfap53 A G 18: 74,492,677 (GRCm39) E467G probably damaging Het
Csmd3 T C 15: 47,683,767 (GRCm39) I1688M probably damaging Het
Cyp3a11 A T 5: 145,799,230 (GRCm39) L319Q probably damaging Het
Dchs2 A G 3: 83,261,570 (GRCm39) I2613V probably benign Het
Dhx35 T A 2: 158,636,839 (GRCm39) W11R probably damaging Het
Dscam C T 16: 96,479,625 (GRCm39) G1174D probably damaging Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Fsip2 A G 2: 82,820,430 (GRCm39) T5388A possibly damaging Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Greb1l T A 18: 10,501,076 (GRCm39) I402K probably benign Het
Hectd3 A T 4: 116,857,821 (GRCm39) M585L probably benign Het
Inpp5k T C 11: 75,524,004 (GRCm39) probably null Het
Lalba T G 15: 98,378,632 (GRCm39) probably null Het
Lgals9 C A 11: 78,862,211 (GRCm39) V125L probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,775,161 (GRCm39) probably null Het
Or2g25 A G 17: 37,971,014 (GRCm39) I70T possibly damaging Het
Peg10 C CTCG 6: 4,756,453 (GRCm39) probably benign Het
Rab4b T A 7: 26,872,379 (GRCm39) D94V probably damaging Het
Rhpn2 A G 7: 35,071,864 (GRCm39) E243G probably benign Het
Rp1 T C 1: 4,415,994 (GRCm39) D1706G probably damaging Het
Slc29a3 A T 10: 60,551,805 (GRCm39) I413N probably damaging Het
Slc7a9 T C 7: 35,154,064 (GRCm39) L229P probably damaging Het
Tenm2 T C 11: 36,755,686 (GRCm39) H104R probably benign Het
Tmem87a A G 2: 120,210,231 (GRCm39) Y241H probably damaging Het
Trpv5 G T 6: 41,651,602 (GRCm39) T192K probably damaging Het
Unc79 T C 12: 103,134,595 (GRCm39) V2189A probably damaging Het
Vmn2r106 A C 17: 20,499,361 (GRCm39) S183R probably benign Het
Vmn2r112 G T 17: 22,837,216 (GRCm39) C559F probably damaging Het
Wdhd1 T C 14: 47,481,324 (GRCm39) D1031G possibly damaging Het
Wnt5b T C 6: 119,410,457 (GRCm39) S328G probably benign Het
Zcchc7 T C 4: 44,926,032 (GRCm39) Y344H probably damaging Het
Other mutations in Bhlhe40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Bhlhe40 APN 6 108,638,139 (GRCm39) missense probably benign 0.25
IGL01146:Bhlhe40 APN 6 108,641,901 (GRCm39) missense possibly damaging 0.60
IGL02950:Bhlhe40 APN 6 108,641,503 (GRCm39) missense probably damaging 1.00
teedoff UTSW 6 108,641,818 (GRCm39) frame shift probably null
R0360:Bhlhe40 UTSW 6 108,641,711 (GRCm39) missense probably damaging 1.00
R1486:Bhlhe40 UTSW 6 108,641,890 (GRCm39) missense probably damaging 1.00
R5041:Bhlhe40 UTSW 6 108,639,546 (GRCm39) missense probably damaging 0.99
R5179:Bhlhe40 UTSW 6 108,642,169 (GRCm39) missense possibly damaging 0.55
R5913:Bhlhe40 UTSW 6 108,642,154 (GRCm39) missense possibly damaging 0.79
R6281:Bhlhe40 UTSW 6 108,641,423 (GRCm39) splice site probably null
R6283:Bhlhe40 UTSW 6 108,641,992 (GRCm39) missense probably damaging 1.00
R6406:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6595:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6654:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6656:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6657:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6659:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6734:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6968:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7105:Bhlhe40 UTSW 6 108,641,997 (GRCm39) missense possibly damaging 0.96
R7323:Bhlhe40 UTSW 6 108,642,242 (GRCm39) missense probably benign 0.42
R7395:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7399:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7472:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7563:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7726:Bhlhe40 UTSW 6 108,639,559 (GRCm39) missense probably benign
R8058:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8319:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8320:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8380:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8381:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8428:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8431:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8432:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8988:Bhlhe40 UTSW 6 108,639,518 (GRCm39) missense probably damaging 1.00
R9381:Bhlhe40 UTSW 6 108,642,244 (GRCm39) missense probably damaging 1.00
R9582:Bhlhe40 UTSW 6 108,638,467 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GAAATCTTCCCAGCTCGTCAC -3'
(R):5'- GGAACCCATCAGATCACTGC -3'

Sequencing Primer
(F):5'- TGCTTCCAGGAAACCATTGG -3'
(R):5'- TCAGATCACTGCCCGCGAAG -3'
Posted On 2018-05-04