Incidental Mutation 'R6405:Bhlhe40'
ID516251
Institutional Source Beutler Lab
Gene Symbol Bhlhe40
Ensembl Gene ENSMUSG00000030103
Gene Namebasic helix-loop-helix family, member e40
SynonymsStra13, C130042M06Rik, eip1 (E47 interaction protein 1), Sharp2, Stra14, DEC1, Bhlhb2, cytokine response gene 8, CR8, Clast5
MMRRC Submission
Accession Numbers

Genbank: NM_011498; MGI: 1097714

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6405 (G1)
Quality Score217.468
Status Not validated
Chromosome6
Chromosomal Location108660629-108666925 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TG to TGG at 108664857 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000032194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032194] [ENSMUST00000163617]
Predicted Effect probably null
Transcript: ENSMUST00000032194
SMART Domains Protein: ENSMUSP00000032194
Gene: ENSMUSG00000030103

DomainStartEndE-ValueType
HLH 58 113 2.52e-11 SMART
ORANGE 140 184 5.91e-13 SMART
low complexity region 230 248 N/A INTRINSIC
low complexity region 372 399 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137478
Predicted Effect probably benign
Transcript: ENSMUST00000163617
SMART Domains Protein: ENSMUSP00000132157
Gene: ENSMUSG00000030103

DomainStartEndE-ValueType
HLH 58 113 2.52e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204550
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a basic helix-loop-helix protein expressed in various tissues. The encoded protein can interact with Arntl or compete for E-box binding sites in the promoter of Per1 and repress Clock/Arntl's transactivation of Per1. This gene is believed to be involved in the control of circadian rhythm and cell differentiation. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in impaired immune function and hyperplasia of the lymphoid organs. Aging mutant animals exhibit autoimmune disease. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,851,878 V769A probably damaging Het
Abca4 A G 3: 122,173,662 probably null Het
Ahnak2 A T 12: 112,773,337 S628T probably damaging Het
Ano8 T C 8: 71,483,030 T315A probably damaging Het
Arhgap32 T A 9: 32,248,488 V267E probably benign Het
Asnsd1 A T 1: 53,347,995 S158T probably damaging Het
Asxl2 T A 12: 3,493,758 V309E probably damaging Het
Ccdc110 T A 8: 45,941,697 Y208* probably null Het
Cfap157 G T 2: 32,781,396 Q133K probably damaging Het
Cfap53 A G 18: 74,359,606 E467G probably damaging Het
Csmd3 T C 15: 47,820,371 I1688M probably damaging Het
Cyp3a11 A T 5: 145,862,420 L319Q probably damaging Het
Dchs2 A G 3: 83,354,263 I2613V probably benign Het
Dhx35 T A 2: 158,794,919 W11R probably damaging Het
Dscam C T 16: 96,678,425 G1174D probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Greb1l T A 18: 10,501,076 I402K probably benign Het
Hectd3 A T 4: 117,000,624 M585L probably benign Het
Inpp5k T C 11: 75,633,178 probably null Het
Lalba T G 15: 98,480,751 probably null Het
Lgals9 C A 11: 78,971,385 V125L probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Olfr117 A G 17: 37,660,123 I70T possibly damaging Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Rab4b T A 7: 27,172,954 D94V probably damaging Het
Rhpn2 A G 7: 35,372,439 E243G probably benign Het
Rp1 T C 1: 4,345,771 D1706G probably damaging Het
Slc29a3 A T 10: 60,716,026 I413N probably damaging Het
Slc7a9 T C 7: 35,454,639 L229P probably damaging Het
Tenm2 T C 11: 36,864,859 H104R probably benign Het
Tmem87a A G 2: 120,379,750 Y241H probably damaging Het
Trpv5 G T 6: 41,674,668 T192K probably damaging Het
Unc79 T C 12: 103,168,336 V2189A probably damaging Het
Vmn2r106 A C 17: 20,279,099 S183R probably benign Het
Vmn2r112 G T 17: 22,618,235 C559F probably damaging Het
Wdhd1 T C 14: 47,243,867 D1031G possibly damaging Het
Wnt5b T C 6: 119,433,496 S328G probably benign Het
Zcchc7 T C 4: 44,926,032 Y344H probably damaging Het
Other mutations in Bhlhe40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Bhlhe40 APN 6 108661178 missense probably benign 0.25
IGL01146:Bhlhe40 APN 6 108664940 missense possibly damaging 0.60
IGL02950:Bhlhe40 APN 6 108664542 missense probably damaging 1.00
teedoff UTSW 6 108664857 frame shift probably null
R0360:Bhlhe40 UTSW 6 108664750 missense probably damaging 1.00
R1486:Bhlhe40 UTSW 6 108664929 missense probably damaging 1.00
R5041:Bhlhe40 UTSW 6 108662585 missense probably damaging 0.99
R5179:Bhlhe40 UTSW 6 108665208 missense possibly damaging 0.55
R5913:Bhlhe40 UTSW 6 108665193 missense possibly damaging 0.79
R6281:Bhlhe40 UTSW 6 108664462 splice site probably null
R6283:Bhlhe40 UTSW 6 108665031 missense probably damaging 1.00
R6406:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6595:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6654:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6656:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6657:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6659:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6734:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6968:Bhlhe40 UTSW 6 108664857 frame shift probably null
R7105:Bhlhe40 UTSW 6 108665036 missense possibly damaging 0.96
R7323:Bhlhe40 UTSW 6 108665281 missense probably benign 0.42
R7395:Bhlhe40 UTSW 6 108664857 frame shift probably null
R7399:Bhlhe40 UTSW 6 108664857 frame shift probably null
R7472:Bhlhe40 UTSW 6 108664857 frame shift probably null
R7563:Bhlhe40 UTSW 6 108664857 frame shift probably null
R7726:Bhlhe40 UTSW 6 108662598 missense probably benign
R8058:Bhlhe40 UTSW 6 108664857 frame shift probably null
R8319:Bhlhe40 UTSW 6 108664857 frame shift probably null
R8320:Bhlhe40 UTSW 6 108664857 frame shift probably null
R8380:Bhlhe40 UTSW 6 108664857 frame shift probably null
R8381:Bhlhe40 UTSW 6 108664857 frame shift probably null
R8428:Bhlhe40 UTSW 6 108664857 frame shift probably null
R8431:Bhlhe40 UTSW 6 108664857 frame shift probably null
R8432:Bhlhe40 UTSW 6 108664857 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GAAATCTTCCCAGCTCGTCAC -3'
(R):5'- GGAACCCATCAGATCACTGC -3'

Sequencing Primer
(F):5'- TGCTTCCAGGAAACCATTGG -3'
(R):5'- TCAGATCACTGCCCGCGAAG -3'
Posted On2018-05-04