Incidental Mutation 'R6405:Rab4b'
ID516253
Institutional Source Beutler Lab
Gene Symbol Rab4b
Ensembl Gene ENSMUSG00000053291
Gene NameRAB4B, member RAS oncogene family
Synonyms1500031G17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6405 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location27168424-27178896 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 27172954 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 94 (D94V)
Ref Sequence ENSEMBL: ENSMUSP00000138477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093040] [ENSMUST00000153511] [ENSMUST00000154724]
Predicted Effect probably benign
Transcript: ENSMUST00000093040
AA Change: M146L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090727
Gene: ENSMUSG00000053291
AA Change: M146L

DomainStartEndE-ValueType
RAB 9 172 2.47e-101 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152753
Predicted Effect probably damaging
Transcript: ENSMUST00000153511
AA Change: D94V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138477
Gene: ENSMUSG00000053291
AA Change: D94V

DomainStartEndE-ValueType
Pfam:Arf 3 97 1.8e-11 PFAM
Pfam:Miro 10 95 9.5e-15 PFAM
Pfam:Ras 10 95 7.8e-35 PFAM
Pfam:Gtr1_RagA 10 98 4.8e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154724
SMART Domains Protein: ENSMUSP00000122859
Gene: ENSMUSG00000095538

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
SH3 46 112 8.92e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175607
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAB proteins, such as RAB4B, are members of the RAS superfamily of small GTPases that are involved in vesicular trafficking (He et al., 2002 [PubMed 12450215]).[supplied by OMIM, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,851,878 V769A probably damaging Het
Abca4 A G 3: 122,173,662 probably null Het
Ahnak2 A T 12: 112,773,337 S628T probably damaging Het
Ano8 T C 8: 71,483,030 T315A probably damaging Het
Arhgap32 T A 9: 32,248,488 V267E probably benign Het
Asnsd1 A T 1: 53,347,995 S158T probably damaging Het
Asxl2 T A 12: 3,493,758 V309E probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ccdc110 T A 8: 45,941,697 Y208* probably null Het
Cfap157 G T 2: 32,781,396 Q133K probably damaging Het
Cfap53 A G 18: 74,359,606 E467G probably damaging Het
Csmd3 T C 15: 47,820,371 I1688M probably damaging Het
Cyp3a11 A T 5: 145,862,420 L319Q probably damaging Het
Dchs2 A G 3: 83,354,263 I2613V probably benign Het
Dhx35 T A 2: 158,794,919 W11R probably damaging Het
Dscam C T 16: 96,678,425 G1174D probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Greb1l T A 18: 10,501,076 I402K probably benign Het
Hectd3 A T 4: 117,000,624 M585L probably benign Het
Inpp5k T C 11: 75,633,178 probably null Het
Lalba T G 15: 98,480,751 probably null Het
Lgals9 C A 11: 78,971,385 V125L probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Olfr117 A G 17: 37,660,123 I70T possibly damaging Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Rhpn2 A G 7: 35,372,439 E243G probably benign Het
Rp1 T C 1: 4,345,771 D1706G probably damaging Het
Slc29a3 A T 10: 60,716,026 I413N probably damaging Het
Slc7a9 T C 7: 35,454,639 L229P probably damaging Het
Tenm2 T C 11: 36,864,859 H104R probably benign Het
Tmem87a A G 2: 120,379,750 Y241H probably damaging Het
Trpv5 G T 6: 41,674,668 T192K probably damaging Het
Unc79 T C 12: 103,168,336 V2189A probably damaging Het
Vmn2r106 A C 17: 20,279,099 S183R probably benign Het
Vmn2r112 G T 17: 22,618,235 C559F probably damaging Het
Wdhd1 T C 14: 47,243,867 D1031G possibly damaging Het
Wnt5b T C 6: 119,433,496 S328G probably benign Het
Zcchc7 T C 4: 44,926,032 Y344H probably damaging Het
Other mutations in Rab4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Rab4b APN 7 27172726 missense probably damaging 0.97
IGL02238:Rab4b APN 7 27172729 missense probably benign 0.21
PIT4802001:Rab4b UTSW 7 27175842 missense probably benign 0.01
R0103:Rab4b UTSW 7 27174502 missense probably benign 0.07
R0103:Rab4b UTSW 7 27174502 missense probably benign 0.07
R4152:Rab4b UTSW 7 27176126 utr 3 prime probably benign
R4735:Rab4b UTSW 7 27172766 splice site probably benign
R5399:Rab4b UTSW 7 27176162 missense probably benign 0.00
R5930:Rab4b UTSW 7 27174502 missense probably benign 0.07
R6886:Rab4b UTSW 7 27172956 missense probably damaging 0.97
R7635:Rab4b UTSW 7 27176217 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCCAGACATGTTCCTCG -3'
(R):5'- AGAAGTCTCAGCTAAGCCAGGG -3'

Sequencing Primer
(F):5'- AGACATGTTCCTCGGAGCC -3'
(R):5'- AGAAGGGCCTCCTGACTCAG -3'
Posted On2018-05-04