Incidental Mutation 'R6405:Rhpn2'
ID516254
Institutional Source Beutler Lab
Gene Symbol Rhpn2
Ensembl Gene ENSMUSG00000030494
Gene Namerhophilin, Rho GTPase binding protein 2
SynonymsD7Ertd784e, 1300002E07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.360) question?
Stock #R6405 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location35334170-35392289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35372439 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 243 (E243G)
Ref Sequence ENSEMBL: ENSMUSP00000082692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032705] [ENSMUST00000085556]
Predicted Effect probably benign
Transcript: ENSMUST00000032705
AA Change: E243G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000032705
Gene: ENSMUSG00000030494
AA Change: E243G

DomainStartEndE-ValueType
Hr1 38 101 2.42e-12 SMART
BRO1 111 513 1.27e-167 SMART
PDZ 524 594 1.73e-9 SMART
low complexity region 623 637 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085556
AA Change: E243G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000082692
Gene: ENSMUSG00000030494
AA Change: E243G

DomainStartEndE-ValueType
Hr1 38 101 2.42e-12 SMART
BRO1 111 513 1.27e-167 SMART
PDZ 524 594 1.73e-9 SMART
low complexity region 623 637 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the rhophilin family of Ras-homologous (Rho)-GTPase binding proteins. The encoded protein binds both GTP- and GDP-bound RhoA and GTP-bound RhoB and may be involved in the organization of the actin cytoskeleton. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous null mice are fertile and have normal body weight and size, normal thyroid morphology and function, and normal brain, lung, ovary, testis, and kidney morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,851,878 V769A probably damaging Het
Abca4 A G 3: 122,173,662 probably null Het
Ahnak2 A T 12: 112,773,337 S628T probably damaging Het
Ano8 T C 8: 71,483,030 T315A probably damaging Het
Arhgap32 T A 9: 32,248,488 V267E probably benign Het
Asnsd1 A T 1: 53,347,995 S158T probably damaging Het
Asxl2 T A 12: 3,493,758 V309E probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ccdc110 T A 8: 45,941,697 Y208* probably null Het
Cfap157 G T 2: 32,781,396 Q133K probably damaging Het
Cfap53 A G 18: 74,359,606 E467G probably damaging Het
Csmd3 T C 15: 47,820,371 I1688M probably damaging Het
Cyp3a11 A T 5: 145,862,420 L319Q probably damaging Het
Dchs2 A G 3: 83,354,263 I2613V probably benign Het
Dhx35 T A 2: 158,794,919 W11R probably damaging Het
Dscam C T 16: 96,678,425 G1174D probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Greb1l T A 18: 10,501,076 I402K probably benign Het
Hectd3 A T 4: 117,000,624 M585L probably benign Het
Inpp5k T C 11: 75,633,178 probably null Het
Lalba T G 15: 98,480,751 probably null Het
Lgals9 C A 11: 78,971,385 V125L probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Olfr117 A G 17: 37,660,123 I70T possibly damaging Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Rab4b T A 7: 27,172,954 D94V probably damaging Het
Rp1 T C 1: 4,345,771 D1706G probably damaging Het
Slc29a3 A T 10: 60,716,026 I413N probably damaging Het
Slc7a9 T C 7: 35,454,639 L229P probably damaging Het
Tenm2 T C 11: 36,864,859 H104R probably benign Het
Tmem87a A G 2: 120,379,750 Y241H probably damaging Het
Trpv5 G T 6: 41,674,668 T192K probably damaging Het
Unc79 T C 12: 103,168,336 V2189A probably damaging Het
Vmn2r106 A C 17: 20,279,099 S183R probably benign Het
Vmn2r112 G T 17: 22,618,235 C559F probably damaging Het
Wdhd1 T C 14: 47,243,867 D1031G possibly damaging Het
Wnt5b T C 6: 119,433,496 S328G probably benign Het
Zcchc7 T C 4: 44,926,032 Y344H probably damaging Het
Other mutations in Rhpn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Rhpn2 APN 7 35370760 missense probably damaging 1.00
IGL01718:Rhpn2 APN 7 35370754 missense probably benign 0.03
IGL01833:Rhpn2 APN 7 35376171 missense probably benign 0.04
IGL02134:Rhpn2 APN 7 35371111 splice site probably benign
IGL02725:Rhpn2 APN 7 35379606 missense probably damaging 0.99
PIT4382001:Rhpn2 UTSW 7 35390753 critical splice acceptor site probably null
R0433:Rhpn2 UTSW 7 35385474 missense probably benign 0.00
R1659:Rhpn2 UTSW 7 35377041 missense probably damaging 1.00
R1836:Rhpn2 UTSW 7 35372388 missense probably benign 0.30
R2110:Rhpn2 UTSW 7 35377008 missense probably benign 0.01
R2567:Rhpn2 UTSW 7 35381532 critical splice donor site probably null
R4302:Rhpn2 UTSW 7 35390845 missense probably benign 0.01
R4717:Rhpn2 UTSW 7 35334350 missense possibly damaging 0.87
R4832:Rhpn2 UTSW 7 35376349 critical splice donor site probably null
R4890:Rhpn2 UTSW 7 35390803 missense probably benign 0.01
R5119:Rhpn2 UTSW 7 35371124 missense probably damaging 1.00
R5285:Rhpn2 UTSW 7 35381565 intron probably benign
R5563:Rhpn2 UTSW 7 35371227 missense probably damaging 0.98
R5578:Rhpn2 UTSW 7 35370710 missense probably damaging 1.00
R6061:Rhpn2 UTSW 7 35376211 missense possibly damaging 0.82
R6700:Rhpn2 UTSW 7 35376169 missense possibly damaging 0.91
R6776:Rhpn2 UTSW 7 35383769 splice site probably null
R7326:Rhpn2 UTSW 7 35385463 missense probably benign 0.00
R7342:Rhpn2 UTSW 7 35334346 missense probably damaging 1.00
R7455:Rhpn2 UTSW 7 35371244 splice site probably null
R7849:Rhpn2 UTSW 7 35381487 missense probably benign 0.11
Z1177:Rhpn2 UTSW 7 35334373 missense probably benign
Z1177:Rhpn2 UTSW 7 35334374 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAAACAAAAGCCCGATTCCTGTG -3'
(R):5'- TGGTAAGGCATTGGCACTCG -3'

Sequencing Primer
(F):5'- TTTGCGTGCCCAGCAATG -3'
(R):5'- TTCAAGACTGTAAGGCGG -3'
Posted On2018-05-04