Incidental Mutation 'R6405:Ccdc110'
ID516257
Institutional Source Beutler Lab
Gene Symbol Ccdc110
Ensembl Gene ENSMUSG00000071104
Gene Namecoiled-coil domain containing 110
SynonymsLOC212392
MMRRC Submission
Accession Numbers

Genbank: NM_001033246; MGI: 2685018

Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6405 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location45934619-45944145 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 45941697 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 208 (Y208*)
Ref Sequence ENSEMBL: ENSMUSP00000092964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095326] [ENSMUST00000174815]
Predicted Effect probably null
Transcript: ENSMUST00000095326
AA Change: Y208*
SMART Domains Protein: ENSMUSP00000092964
Gene: ENSMUSG00000071104
AA Change: Y208*

DomainStartEndE-ValueType
coiled coil region 442 794 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174815
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,851,878 V769A probably damaging Het
Abca4 A G 3: 122,173,662 probably null Het
Ahnak2 A T 12: 112,773,337 S628T probably damaging Het
Ano8 T C 8: 71,483,030 T315A probably damaging Het
Arhgap32 T A 9: 32,248,488 V267E probably benign Het
Asnsd1 A T 1: 53,347,995 S158T probably damaging Het
Asxl2 T A 12: 3,493,758 V309E probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cfap157 G T 2: 32,781,396 Q133K probably damaging Het
Cfap53 A G 18: 74,359,606 E467G probably damaging Het
Csmd3 T C 15: 47,820,371 I1688M probably damaging Het
Cyp3a11 A T 5: 145,862,420 L319Q probably damaging Het
Dchs2 A G 3: 83,354,263 I2613V probably benign Het
Dhx35 T A 2: 158,794,919 W11R probably damaging Het
Dscam C T 16: 96,678,425 G1174D probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Greb1l T A 18: 10,501,076 I402K probably benign Het
Hectd3 A T 4: 117,000,624 M585L probably benign Het
Inpp5k T C 11: 75,633,178 probably null Het
Lalba T G 15: 98,480,751 probably null Het
Lgals9 C A 11: 78,971,385 V125L probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Olfr117 A G 17: 37,660,123 I70T possibly damaging Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Rab4b T A 7: 27,172,954 D94V probably damaging Het
Rhpn2 A G 7: 35,372,439 E243G probably benign Het
Rp1 T C 1: 4,345,771 D1706G probably damaging Het
Slc29a3 A T 10: 60,716,026 I413N probably damaging Het
Slc7a9 T C 7: 35,454,639 L229P probably damaging Het
Tenm2 T C 11: 36,864,859 H104R probably benign Het
Tmem87a A G 2: 120,379,750 Y241H probably damaging Het
Trpv5 G T 6: 41,674,668 T192K probably damaging Het
Unc79 T C 12: 103,168,336 V2189A probably damaging Het
Vmn2r106 A C 17: 20,279,099 S183R probably benign Het
Vmn2r112 G T 17: 22,618,235 C559F probably damaging Het
Wdhd1 T C 14: 47,243,867 D1031G possibly damaging Het
Wnt5b T C 6: 119,433,496 S328G probably benign Het
Zcchc7 T C 4: 44,926,032 Y344H probably damaging Het
Other mutations in Ccdc110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01898:Ccdc110 APN 8 45942124 missense possibly damaging 0.76
IGL02175:Ccdc110 APN 8 45940623 missense probably benign 0.07
IGL02471:Ccdc110 APN 8 45941756 missense probably benign 0.14
IGL02524:Ccdc110 APN 8 45941942 missense probably benign
IGL02887:Ccdc110 APN 8 45943184 missense probably benign 0.01
IGL03227:Ccdc110 APN 8 45941549 missense probably damaging 1.00
IGL03238:Ccdc110 APN 8 45941822 missense probably benign 0.00
droll UTSW 8 45942827 missense probably benign 0.10
humorless UTSW 8 45943450 missense probably benign 0.03
R0049:Ccdc110 UTSW 8 45942626 missense probably damaging 1.00
R0049:Ccdc110 UTSW 8 45942626 missense probably damaging 1.00
R0110:Ccdc110 UTSW 8 45935157 missense probably benign 0.00
R0189:Ccdc110 UTSW 8 45935082 missense probably damaging 0.98
R0218:Ccdc110 UTSW 8 45934724 splice site probably benign
R0280:Ccdc110 UTSW 8 45943450 missense probably benign 0.03
R0332:Ccdc110 UTSW 8 45942964 nonsense probably null
R0371:Ccdc110 UTSW 8 45942806 missense possibly damaging 0.86
R0469:Ccdc110 UTSW 8 45935157 missense probably benign 0.00
R0502:Ccdc110 UTSW 8 45934724 splice site probably benign
R0510:Ccdc110 UTSW 8 45935157 missense probably benign 0.00
R0534:Ccdc110 UTSW 8 45935138 missense possibly damaging 0.73
R0647:Ccdc110 UTSW 8 45943388 missense probably damaging 0.99
R0714:Ccdc110 UTSW 8 45943010 missense possibly damaging 0.71
R0721:Ccdc110 UTSW 8 45941989 missense probably benign
R1029:Ccdc110 UTSW 8 45941780 missense probably damaging 0.98
R1147:Ccdc110 UTSW 8 45944084 missense possibly damaging 0.64
R1147:Ccdc110 UTSW 8 45944084 missense possibly damaging 0.64
R1170:Ccdc110 UTSW 8 45941885 missense probably benign 0.22
R1340:Ccdc110 UTSW 8 45942181 missense probably benign 0.02
R1540:Ccdc110 UTSW 8 45942325 nonsense probably null
R1587:Ccdc110 UTSW 8 45941746 missense probably benign 0.01
R1602:Ccdc110 UTSW 8 45938918 missense probably benign 0.12
R1629:Ccdc110 UTSW 8 45942127 missense probably benign 0.08
R1842:Ccdc110 UTSW 8 45940568 missense probably damaging 1.00
R1933:Ccdc110 UTSW 8 45943250 missense probably damaging 1.00
R1934:Ccdc110 UTSW 8 45943250 missense probably damaging 1.00
R2006:Ccdc110 UTSW 8 45943312 missense probably damaging 1.00
R2043:Ccdc110 UTSW 8 45942827 missense probably benign 0.10
R2093:Ccdc110 UTSW 8 45942077 missense probably damaging 1.00
R2165:Ccdc110 UTSW 8 45942839 missense probably benign 0.00
R3613:Ccdc110 UTSW 8 45942806 missense possibly damaging 0.86
R3923:Ccdc110 UTSW 8 45942389 missense probably damaging 1.00
R4648:Ccdc110 UTSW 8 45942668 missense possibly damaging 0.95
R4773:Ccdc110 UTSW 8 45943208 missense probably damaging 1.00
R4901:Ccdc110 UTSW 8 45943400 missense probably benign 0.35
R4911:Ccdc110 UTSW 8 45942907 missense probably benign 0.00
R4923:Ccdc110 UTSW 8 45943423 missense probably benign 0.29
R5104:Ccdc110 UTSW 8 45942692 missense probably damaging 0.99
R5561:Ccdc110 UTSW 8 45940609 missense probably benign 0.02
R5966:Ccdc110 UTSW 8 45942536 missense probably damaging 1.00
R5976:Ccdc110 UTSW 8 45943499 missense possibly damaging 0.71
R6141:Ccdc110 UTSW 8 45941770 missense possibly damaging 0.89
R6326:Ccdc110 UTSW 8 45942041 missense probably damaging 1.00
R6366:Ccdc110 UTSW 8 45943388 missense probably damaging 0.99
R6482:Ccdc110 UTSW 8 45942788 missense probably benign 0.00
R6815:Ccdc110 UTSW 8 45941987 missense probably benign 0.19
R7387:Ccdc110 UTSW 8 45942196 missense probably benign 0.00
R7680:Ccdc110 UTSW 8 45941651 missense possibly damaging 0.64
X0053:Ccdc110 UTSW 8 45942961 missense possibly damaging 0.56
X0054:Ccdc110 UTSW 8 45941843 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTAGTAACAGTGACACTGGTC -3'
(R):5'- ACCTTGAGTACTCGCGTCTG -3'

Sequencing Primer
(F):5'- AGTGACACTGGTCTCCCTCAG -3'
(R):5'- ACTTGTGAGTGCCAGCTC -3'
Posted On2018-05-04