Incidental Mutation 'R6405:Slc29a3'
ID516260
Institutional Source Beutler Lab
Gene Symbol Slc29a3
Ensembl Gene ENSMUSG00000020100
Gene Namesolute carrier family 29 (nucleoside transporters), member 3
Synonyms4933435C21Rik, Ent3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R6405 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location60712072-60752794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 60716026 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 413 (I413N)
Ref Sequence ENSEMBL: ENSMUSP00000112685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117513] [ENSMUST00000119595] [ENSMUST00000150845]
Predicted Effect probably damaging
Transcript: ENSMUST00000117513
AA Change: I413N

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112685
Gene: ENSMUSG00000020100
AA Change: I413N

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 107 126 N/A INTRINSIC
transmembrane domain 133 155 N/A INTRINSIC
Pfam:Nucleoside_tran 169 473 2.2e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119595
SMART Domains Protein: ENSMUSP00000112426
Gene: ENSMUSG00000020100

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 107 126 N/A INTRINSIC
transmembrane domain 133 155 N/A INTRINSIC
transmembrane domain 165 187 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144989
Predicted Effect probably benign
Transcript: ENSMUST00000150845
SMART Domains Protein: ENSMUSP00000119716
Gene: ENSMUSG00000020100

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 117 125 N/A INTRINSIC
low complexity region 144 155 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleoside transporter. The encoded protein plays a role in cellular uptake of nucleosides, nucleobases, and their related analogs. Mutations in this gene have been associated with H syndrome, which is characterized by cutaneous hyperpigmentation and hypertrichosis, hepatosplenomegaly, heart anomalies, and hypogonadism. A related disorder, PHID (pigmented hypertrichosis with insulin-dependent diabetes mellitus), has also been associated with mutations at this locus. Alternatively spliced transcript variants have been described.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lymphadenopathy, splenomegaly, histiocytic sarcoma, and premature death associated with extramedullary hematopoiesis, increased macrophage proliferation and apoptosis and abnormal lysosome function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,851,878 V769A probably damaging Het
Abca4 A G 3: 122,173,662 probably null Het
Ahnak2 A T 12: 112,773,337 S628T probably damaging Het
Ano8 T C 8: 71,483,030 T315A probably damaging Het
Arhgap32 T A 9: 32,248,488 V267E probably benign Het
Asnsd1 A T 1: 53,347,995 S158T probably damaging Het
Asxl2 T A 12: 3,493,758 V309E probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ccdc110 T A 8: 45,941,697 Y208* probably null Het
Cfap157 G T 2: 32,781,396 Q133K probably damaging Het
Cfap53 A G 18: 74,359,606 E467G probably damaging Het
Csmd3 T C 15: 47,820,371 I1688M probably damaging Het
Cyp3a11 A T 5: 145,862,420 L319Q probably damaging Het
Dchs2 A G 3: 83,354,263 I2613V probably benign Het
Dhx35 T A 2: 158,794,919 W11R probably damaging Het
Dscam C T 16: 96,678,425 G1174D probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Greb1l T A 18: 10,501,076 I402K probably benign Het
Hectd3 A T 4: 117,000,624 M585L probably benign Het
Inpp5k T C 11: 75,633,178 probably null Het
Lalba T G 15: 98,480,751 probably null Het
Lgals9 C A 11: 78,971,385 V125L probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Olfr117 A G 17: 37,660,123 I70T possibly damaging Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Rab4b T A 7: 27,172,954 D94V probably damaging Het
Rhpn2 A G 7: 35,372,439 E243G probably benign Het
Rp1 T C 1: 4,345,771 D1706G probably damaging Het
Slc7a9 T C 7: 35,454,639 L229P probably damaging Het
Tenm2 T C 11: 36,864,859 H104R probably benign Het
Tmem87a A G 2: 120,379,750 Y241H probably damaging Het
Trpv5 G T 6: 41,674,668 T192K probably damaging Het
Unc79 T C 12: 103,168,336 V2189A probably damaging Het
Vmn2r106 A C 17: 20,279,099 S183R probably benign Het
Vmn2r112 G T 17: 22,618,235 C559F probably damaging Het
Wdhd1 T C 14: 47,243,867 D1031G possibly damaging Het
Wnt5b T C 6: 119,433,496 S328G probably benign Het
Zcchc7 T C 4: 44,926,032 Y344H probably damaging Het
Other mutations in Slc29a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Slc29a3 APN 10 60723817 missense possibly damaging 0.95
R1967:Slc29a3 UTSW 10 60716464 missense probably benign
R1986:Slc29a3 UTSW 10 60723814 missense probably damaging 1.00
R2206:Slc29a3 UTSW 10 60715907 missense possibly damaging 0.87
R3891:Slc29a3 UTSW 10 60716261 nonsense probably null
R4734:Slc29a3 UTSW 10 60716326 missense probably benign 0.01
R4748:Slc29a3 UTSW 10 60716326 missense probably benign 0.01
R4749:Slc29a3 UTSW 10 60716326 missense probably benign 0.01
R5682:Slc29a3 UTSW 10 60716212 missense probably benign 0.00
R5938:Slc29a3 UTSW 10 60752784 unclassified probably benign
R6104:Slc29a3 UTSW 10 60721002 missense possibly damaging 0.77
R7341:Slc29a3 UTSW 10 60750658 missense probably benign 0.25
R7683:Slc29a3 UTSW 10 60716366 missense not run
RF009:Slc29a3 UTSW 10 60750561 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAAGTGTTCAAGCAGGGCCG -3'
(R):5'- TGGACCTCCAAGTTCTTCGTG -3'

Sequencing Primer
(F):5'- CAATCTTGGGCCCATAGA -3'
(R):5'- AAGTTCTTCGTGCCCCTCAC -3'
Posted On2018-05-04