Incidental Mutation 'R6405:Lgals9'
ID516263
Institutional Source Beutler Lab
Gene Symbol Lgals9
Ensembl Gene ENSMUSG00000001123
Gene Namelectin, galactose binding, soluble 9
SynonymsLgals5, galectin-9, LGALS35, gal-9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6405 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location78962974-78984946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 78971385 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 125 (V125L)
Ref Sequence ENSEMBL: ENSMUSP00000103903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073001] [ENSMUST00000108268] [ENSMUST00000108269]
Predicted Effect probably benign
Transcript: ENSMUST00000073001
AA Change: V125L

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000072764
Gene: ENSMUSG00000001123
AA Change: V125L

DomainStartEndE-ValueType
GLECT 15 147 6.58e-55 SMART
Gal-bind_lectin 21 146 5.24e-55 SMART
GLECT 222 352 5.38e-60 SMART
Gal-bind_lectin 228 352 1.33e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108268
AA Change: V125L

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103903
Gene: ENSMUSG00000001123
AA Change: V125L

DomainStartEndE-ValueType
GLECT 15 147 6.58e-55 SMART
Gal-bind_lectin 21 146 5.24e-55 SMART
GLECT 192 322 5.38e-60 SMART
Gal-bind_lectin 198 322 1.33e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108269
AA Change: V125L

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000103904
Gene: ENSMUSG00000001123
AA Change: V125L

DomainStartEndE-ValueType
GLECT 15 147 6.58e-55 SMART
Gal-bind_lectin 21 146 5.24e-55 SMART
GLECT 223 353 5.38e-60 SMART
Gal-bind_lectin 229 353 1.33e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140073
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was initially thought to represent a pseudogene of galectin 9; however, this transcript has good exon-intron structure and encodes a predicted protein of the same size as and highly similar to galectin 9. This gene is one of two similar loci on chromosome 17p similar to galectin 9 and now thought to be protein-encoding. This gene is the more centromeric gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased susceptibility to collagen-induced arthritis, increased T-helper 1 cells and decreased regulatory T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,851,878 V769A probably damaging Het
Abca4 A G 3: 122,173,662 probably null Het
Ahnak2 A T 12: 112,773,337 S628T probably damaging Het
Ano8 T C 8: 71,483,030 T315A probably damaging Het
Arhgap32 T A 9: 32,248,488 V267E probably benign Het
Asnsd1 A T 1: 53,347,995 S158T probably damaging Het
Asxl2 T A 12: 3,493,758 V309E probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ccdc110 T A 8: 45,941,697 Y208* probably null Het
Cfap157 G T 2: 32,781,396 Q133K probably damaging Het
Cfap53 A G 18: 74,359,606 E467G probably damaging Het
Csmd3 T C 15: 47,820,371 I1688M probably damaging Het
Cyp3a11 A T 5: 145,862,420 L319Q probably damaging Het
Dchs2 A G 3: 83,354,263 I2613V probably benign Het
Dhx35 T A 2: 158,794,919 W11R probably damaging Het
Dscam C T 16: 96,678,425 G1174D probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Greb1l T A 18: 10,501,076 I402K probably benign Het
Hectd3 A T 4: 117,000,624 M585L probably benign Het
Inpp5k T C 11: 75,633,178 probably null Het
Lalba T G 15: 98,480,751 probably null Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Olfr117 A G 17: 37,660,123 I70T possibly damaging Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Rab4b T A 7: 27,172,954 D94V probably damaging Het
Rhpn2 A G 7: 35,372,439 E243G probably benign Het
Rp1 T C 1: 4,345,771 D1706G probably damaging Het
Slc29a3 A T 10: 60,716,026 I413N probably damaging Het
Slc7a9 T C 7: 35,454,639 L229P probably damaging Het
Tenm2 T C 11: 36,864,859 H104R probably benign Het
Tmem87a A G 2: 120,379,750 Y241H probably damaging Het
Trpv5 G T 6: 41,674,668 T192K probably damaging Het
Unc79 T C 12: 103,168,336 V2189A probably damaging Het
Vmn2r106 A C 17: 20,279,099 S183R probably benign Het
Vmn2r112 G T 17: 22,618,235 C559F probably damaging Het
Wdhd1 T C 14: 47,243,867 D1031G possibly damaging Het
Wnt5b T C 6: 119,433,496 S328G probably benign Het
Zcchc7 T C 4: 44,926,032 Y344H probably damaging Het
Other mutations in Lgals9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Lgals9 APN 11 78973151 missense probably damaging 1.00
IGL01415:Lgals9 APN 11 78973151 missense probably damaging 1.00
IGL02194:Lgals9 APN 11 78966920 critical splice acceptor site probably null
IGL02390:Lgals9 APN 11 78963535 missense probably damaging 1.00
IGL02987:Lgals9 APN 11 78967477 missense possibly damaging 0.93
IGL03288:Lgals9 APN 11 78984800 missense probably benign 0.01
IGL03388:Lgals9 APN 11 78963421 missense probably damaging 0.99
R0057:Lgals9 UTSW 11 78971436 splice site probably benign
R0143:Lgals9 UTSW 11 78963535 missense probably damaging 1.00
R0325:Lgals9 UTSW 11 78963448 missense probably damaging 0.99
R0522:Lgals9 UTSW 11 78965812 missense possibly damaging 0.95
R0542:Lgals9 UTSW 11 78969720 missense possibly damaging 0.68
R0673:Lgals9 UTSW 11 78965853 missense probably damaging 1.00
R1312:Lgals9 UTSW 11 78976617 nonsense probably null
R2000:Lgals9 UTSW 11 78973170 missense probably benign 0.01
R4083:Lgals9 UTSW 11 78969763 missense possibly damaging 0.63
R4084:Lgals9 UTSW 11 78969763 missense possibly damaging 0.63
R4157:Lgals9 UTSW 11 78973107 missense possibly damaging 0.88
R4204:Lgals9 UTSW 11 78969816 splice site probably benign
R4892:Lgals9 UTSW 11 78966083 missense probably benign 0.00
R5650:Lgals9 UTSW 11 78973154 missense probably damaging 0.97
R6155:Lgals9 UTSW 11 78963505 missense probably benign 0.16
R6166:Lgals9 UTSW 11 78971358 missense probably benign 0.14
R6853:Lgals9 UTSW 11 78966006 missense probably benign 0.16
R8035:Lgals9 UTSW 11 78963476 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTACCTGGGGAAGATGCTTG -3'
(R):5'- TAAGTAAGTGAATGCCCGCAG -3'

Sequencing Primer
(F):5'- AAGATGCTTGCTGGTGCCC -3'
(R):5'- TCTGAGTGCAGTGGCTCAC -3'
Posted On2018-05-04