Incidental Mutation 'R6405:Asxl2'
ID516264
Institutional Source Beutler Lab
Gene Symbol Asxl2
Ensembl Gene ENSMUSG00000037486
Gene Nameadditional sex combs like 2, transcriptional regulator
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R6405 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location3426857-3506852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3493758 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 309 (V309E)
Ref Sequence ENSEMBL: ENSMUSP00000089629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092003] [ENSMUST00000111215] [ENSMUST00000144247] [ENSMUST00000153102]
Predicted Effect probably damaging
Transcript: ENSMUST00000092003
AA Change: V309E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000089629
Gene: ENSMUSG00000037486
AA Change: V309E

DomainStartEndE-ValueType
Pfam:HARE-HTH 11 83 1.2e-22 PFAM
low complexity region 95 122 N/A INTRINSIC
low complexity region 126 154 N/A INTRINSIC
low complexity region 162 185 N/A INTRINSIC
Pfam:ASXH 204 336 1.2e-52 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111215
AA Change: V309E

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106846
Gene: ENSMUSG00000037486
AA Change: V309E

DomainStartEndE-ValueType
Pfam:HARE-HTH 11 83 3.6e-22 PFAM
low complexity region 95 122 N/A INTRINSIC
low complexity region 126 154 N/A INTRINSIC
low complexity region 162 185 N/A INTRINSIC
Pfam:ASXH 204 336 4.2e-52 PFAM
low complexity region 614 637 N/A INTRINSIC
low complexity region 640 658 N/A INTRINSIC
low complexity region 849 870 N/A INTRINSIC
low complexity region 1115 1124 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
Pfam:PHD_3 1305 1368 1.1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138740
SMART Domains Protein: ENSMUSP00000133639
Gene: ENSMUSG00000037486

DomainStartEndE-ValueType
Pfam:HARE-HTH 1 54 1.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144247
AA Change: V357E

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000116048
Gene: ENSMUSG00000037486
AA Change: V357E

DomainStartEndE-ValueType
Pfam:HARE-HTH 11 83 5.2e-23 PFAM
low complexity region 95 122 N/A INTRINSIC
low complexity region 126 154 N/A INTRINSIC
low complexity region 162 185 N/A INTRINSIC
low complexity region 221 244 N/A INTRINSIC
Pfam:ASXH 252 384 7e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152196
Predicted Effect possibly damaging
Transcript: ENSMUST00000153102
AA Change: V309E

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117384
Gene: ENSMUSG00000037486
AA Change: V309E

DomainStartEndE-ValueType
Pfam:HARE-HTH 11 83 1.6e-23 PFAM
low complexity region 95 122 N/A INTRINSIC
low complexity region 126 154 N/A INTRINSIC
low complexity region 162 185 N/A INTRINSIC
Pfam:ASXH 211 335 6.9e-38 PFAM
low complexity region 614 637 N/A INTRINSIC
low complexity region 640 658 N/A INTRINSIC
low complexity region 849 870 N/A INTRINSIC
low complexity region 1115 1124 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
Pfam:PHD_3 1308 1368 7.6e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219208
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a homolog of the Drosophila Asx gene, which interacts with genes involved in axial patterning. Mice with mutations in this gene display abnormal patterning of the axial skeleton, suggesting a similar function in mice as in Drosophila. This gene may also be involved in bone mineral density, specifically osteoclastogenesis. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a severe hypomorphic allele display prenatal and postnatal lethality, premature death, vertebral transformations and splitting, decreased body weight, enlarged hearts, and age-related cardiac interstitial fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,851,878 V769A probably damaging Het
Abca4 A G 3: 122,173,662 probably null Het
Ahnak2 A T 12: 112,773,337 S628T probably damaging Het
Ano8 T C 8: 71,483,030 T315A probably damaging Het
Arhgap32 T A 9: 32,248,488 V267E probably benign Het
Asnsd1 A T 1: 53,347,995 S158T probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ccdc110 T A 8: 45,941,697 Y208* probably null Het
Cfap157 G T 2: 32,781,396 Q133K probably damaging Het
Cfap53 A G 18: 74,359,606 E467G probably damaging Het
Csmd3 T C 15: 47,820,371 I1688M probably damaging Het
Cyp3a11 A T 5: 145,862,420 L319Q probably damaging Het
Dchs2 A G 3: 83,354,263 I2613V probably benign Het
Dhx35 T A 2: 158,794,919 W11R probably damaging Het
Dscam C T 16: 96,678,425 G1174D probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Greb1l T A 18: 10,501,076 I402K probably benign Het
Hectd3 A T 4: 117,000,624 M585L probably benign Het
Inpp5k T C 11: 75,633,178 probably null Het
Lalba T G 15: 98,480,751 probably null Het
Lgals9 C A 11: 78,971,385 V125L probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Olfr117 A G 17: 37,660,123 I70T possibly damaging Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Rab4b T A 7: 27,172,954 D94V probably damaging Het
Rhpn2 A G 7: 35,372,439 E243G probably benign Het
Rp1 T C 1: 4,345,771 D1706G probably damaging Het
Slc29a3 A T 10: 60,716,026 I413N probably damaging Het
Slc7a9 T C 7: 35,454,639 L229P probably damaging Het
Tenm2 T C 11: 36,864,859 H104R probably benign Het
Tmem87a A G 2: 120,379,750 Y241H probably damaging Het
Trpv5 G T 6: 41,674,668 T192K probably damaging Het
Unc79 T C 12: 103,168,336 V2189A probably damaging Het
Vmn2r106 A C 17: 20,279,099 S183R probably benign Het
Vmn2r112 G T 17: 22,618,235 C559F probably damaging Het
Wdhd1 T C 14: 47,243,867 D1031G possibly damaging Het
Wnt5b T C 6: 119,433,496 S328G probably benign Het
Zcchc7 T C 4: 44,926,032 Y344H probably damaging Het
Other mutations in Asxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Asxl2 APN 12 3474560 missense probably damaging 1.00
IGL01301:Asxl2 APN 12 3501425 missense probably damaging 1.00
IGL01325:Asxl2 APN 12 3427172 missense probably damaging 0.98
IGL01689:Asxl2 APN 12 3496425 missense probably benign 0.28
IGL01871:Asxl2 APN 12 3502112 missense probably benign 0.38
IGL02164:Asxl2 APN 12 3502079 missense probably benign 0.00
IGL02609:Asxl2 APN 12 3500018 missense probably damaging 1.00
IGL03191:Asxl2 APN 12 3500094 missense probably damaging 1.00
ANU18:Asxl2 UTSW 12 3501425 missense probably damaging 1.00
R0092:Asxl2 UTSW 12 3496313 missense probably benign 0.00
R0118:Asxl2 UTSW 12 3496923 missense probably damaging 1.00
R0277:Asxl2 UTSW 12 3442487 missense probably damaging 1.00
R0323:Asxl2 UTSW 12 3442487 missense probably damaging 1.00
R0584:Asxl2 UTSW 12 3496632 missense probably damaging 0.96
R0885:Asxl2 UTSW 12 3501458 missense probably damaging 1.00
R1344:Asxl2 UTSW 12 3493790 missense probably damaging 1.00
R1456:Asxl2 UTSW 12 3501872 missense possibly damaging 0.70
R1829:Asxl2 UTSW 12 3457125 missense probably damaging 1.00
R1909:Asxl2 UTSW 12 3474577 missense probably damaging 1.00
R1990:Asxl2 UTSW 12 3484558 nonsense probably null
R2074:Asxl2 UTSW 12 3493779 missense probably damaging 1.00
R2883:Asxl2 UTSW 12 3501830 missense probably benign 0.03
R2912:Asxl2 UTSW 12 3474517 missense probably benign 0.06
R4446:Asxl2 UTSW 12 3501774 missense possibly damaging 0.54
R4662:Asxl2 UTSW 12 3427193 missense probably damaging 0.99
R4726:Asxl2 UTSW 12 3501872 missense possibly damaging 0.70
R5034:Asxl2 UTSW 12 3502193 missense probably damaging 0.98
R5287:Asxl2 UTSW 12 3496893 missense probably benign 0.02
R5377:Asxl2 UTSW 12 3474618 splice site probably null
R5611:Asxl2 UTSW 12 3484598 missense probably damaging 1.00
R5708:Asxl2 UTSW 12 3500603 missense possibly damaging 0.82
R5945:Asxl2 UTSW 12 3500439 missense possibly damaging 0.82
R6154:Asxl2 UTSW 12 3496593 missense possibly damaging 0.60
R6288:Asxl2 UTSW 12 3476040 missense possibly damaging 0.91
R6938:Asxl2 UTSW 12 3476149 missense probably damaging 0.98
R7146:Asxl2 UTSW 12 3457066 missense probably damaging 1.00
R7354:Asxl2 UTSW 12 3455637 intron probably benign
R7396:Asxl2 UTSW 12 3442529 missense probably damaging 0.99
R7438:Asxl2 UTSW 12 3427108 start gained probably benign
R7980:Asxl2 UTSW 12 3496630 missense probably damaging 0.99
R7991:Asxl2 UTSW 12 3484531 missense probably damaging 1.00
R8063:Asxl2 UTSW 12 3500768 missense probably benign 0.01
R8156:Asxl2 UTSW 12 3496760 missense probably benign 0.09
R8396:Asxl2 UTSW 12 3502220 missense probably benign
Z1177:Asxl2 UTSW 12 3474589 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGCCCTTGCTGCATATTG -3'
(R):5'- TGTAGGCACTAGAGTTTCCAATAAGG -3'

Sequencing Primer
(F):5'- GGCCCTTGCTGCATATTGAAAATTAC -3'
(R):5'- GTAAAAACATAGAGGTGTCACATGAC -3'
Posted On2018-05-04