Incidental Mutation 'R6405:Lalba'
ID516269
Institutional Source Beutler Lab
Gene Symbol Lalba
Ensembl Gene ENSMUSG00000022991
Gene Namelactalbumin, alpha
Synonymslactalbumin alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.317) question?
Stock #R6405 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location98480400-98482721 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to G at 98480751 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023726] [ENSMUST00000216180]
PDB Structure
Crystal Structure of Lactose Synthase, Complex with Glucose [X-RAY DIFFRACTION]
Crystal structure of Lactose synthase complex with UDP [X-RAY DIFFRACTION]
Crystal structure of Lactose synthase complex with UDP and Manganese [X-RAY DIFFRACTION]
beta-1,4-galactosyltransferase mutant Cys342Thr complex with alpha-lactalbumin and GlcNAc [X-RAY DIFFRACTION]
crystal structure of lactose synthase, a 1:1 complex between beta1,4-galactosyltransferase and alpha-lactalbumin in the presence of GlcNAc [X-RAY DIFFRACTION]
BETA-1,4-GALACTOSYLTRANSFERASE COMPLEX WITH ALPHA-LACTALBUMIN AND N-BUTANOYL-GLUCOAMINE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF LACTOSE SYNTHASE IN THE PRESENCE OF UDP-GLUCOSE [X-RAY DIFFRACTION]
A 1:1 complex between alpha-lactalbumin and beta1,4-galactosyltransferase in the presence of UDP-N-acetyl-galactosamine [X-RAY DIFFRACTION]
W314A-BETA1,4-GALACTOSYLTRANSFERASE-I COMPLEXED WITH ALPHA-LACTALBUMIN IN THE PRESENCE OF N-ACETYLGLUCOSAMINE, UDP AND MANGANESE [X-RAY DIFFRACTION]
Crystal structure of beta14,-galactosyltransferase mutant ARG228Lys in complex with alpha-lactalbumin in the presence of UDP-galactose and Mn [X-RAY DIFFRACTION]
>> 2 additional structures at PDB <<
Predicted Effect probably null
Transcript: ENSMUST00000023726
SMART Domains Protein: ENSMUSP00000023726
Gene: ENSMUSG00000022991

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LYZ1 21 141 3.77e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216180
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes alpha-lactalbumin, a principal protein of milk. Alpha-lactalbumin forms the regulatory subunit of the lactose synthase (LS) heterodimer and beta 1,4-galactosyltransferase (beta4Gal-T1) forms the catalytic component. Together, these proteins enable LS to produce lactose by transfering galactose moieties to glucose. As a monomer, alpha-lactalbumin strongly binds calcium and zinc ions and may possess bactericidal or antitumor activity. A folding variant of alpha-lactalbumin, called HAMLET, likely induces apoptosis in tumor and immature cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null females are unable to nurse their offspring and have increased milk viscosity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,851,878 V769A probably damaging Het
Abca4 A G 3: 122,173,662 probably null Het
Ahnak2 A T 12: 112,773,337 S628T probably damaging Het
Ano8 T C 8: 71,483,030 T315A probably damaging Het
Arhgap32 T A 9: 32,248,488 V267E probably benign Het
Asnsd1 A T 1: 53,347,995 S158T probably damaging Het
Asxl2 T A 12: 3,493,758 V309E probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ccdc110 T A 8: 45,941,697 Y208* probably null Het
Cfap157 G T 2: 32,781,396 Q133K probably damaging Het
Cfap53 A G 18: 74,359,606 E467G probably damaging Het
Csmd3 T C 15: 47,820,371 I1688M probably damaging Het
Cyp3a11 A T 5: 145,862,420 L319Q probably damaging Het
Dchs2 A G 3: 83,354,263 I2613V probably benign Het
Dhx35 T A 2: 158,794,919 W11R probably damaging Het
Dscam C T 16: 96,678,425 G1174D probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Greb1l T A 18: 10,501,076 I402K probably benign Het
Hectd3 A T 4: 117,000,624 M585L probably benign Het
Inpp5k T C 11: 75,633,178 probably null Het
Lgals9 C A 11: 78,971,385 V125L probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Olfr117 A G 17: 37,660,123 I70T possibly damaging Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Rab4b T A 7: 27,172,954 D94V probably damaging Het
Rhpn2 A G 7: 35,372,439 E243G probably benign Het
Rp1 T C 1: 4,345,771 D1706G probably damaging Het
Slc29a3 A T 10: 60,716,026 I413N probably damaging Het
Slc7a9 T C 7: 35,454,639 L229P probably damaging Het
Tenm2 T C 11: 36,864,859 H104R probably benign Het
Tmem87a A G 2: 120,379,750 Y241H probably damaging Het
Trpv5 G T 6: 41,674,668 T192K probably damaging Het
Unc79 T C 12: 103,168,336 V2189A probably damaging Het
Vmn2r106 A C 17: 20,279,099 S183R probably benign Het
Vmn2r112 G T 17: 22,618,235 C559F probably damaging Het
Wdhd1 T C 14: 47,243,867 D1031G possibly damaging Het
Wnt5b T C 6: 119,433,496 S328G probably benign Het
Zcchc7 T C 4: 44,926,032 Y344H probably damaging Het
Other mutations in Lalba
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Lalba APN 15 98482067 splice site probably null
R4510:Lalba UTSW 15 98482541 missense probably benign 0.01
R4511:Lalba UTSW 15 98482541 missense probably benign 0.01
R4630:Lalba UTSW 15 98482668 missense probably benign 0.13
R4914:Lalba UTSW 15 98482180 missense probably benign 0.22
R7706:Lalba UTSW 15 98481593 missense probably damaging 1.00
R7727:Lalba UTSW 15 98482668 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GGTGTCACTACAGGGTACAAGG -3'
(R):5'- GCTTTATGCTAGTCACTGACAACC -3'

Sequencing Primer
(F):5'- AGGCTCAGAGGCAGATCATCTTC -3'
(R):5'- GTCACTGACAACCATCATTAAGAGGG -3'
Posted On2018-05-04