Incidental Mutation 'R6405:Gm10549'
ID516277
Institutional Source Beutler Lab
Gene Symbol Gm10549
Ensembl Gene ENSMUSG00000073610
Gene Namepredicted gene 10549
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6405 (G1)
Quality Score98.0078
Status Not validated
Chromosome18
Chromosomal Location33464163-33472448 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 33464305 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051087] [ENSMUST00000097634] [ENSMUST00000168890] [ENSMUST00000171533]
Predicted Effect probably benign
Transcript: ENSMUST00000051087
SMART Domains Protein: ENSMUSP00000058132
Gene: ENSMUSG00000042834

DomainStartEndE-ValueType
Pfam:Alveol-reg_P311 1 68 2.6e-41 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000097634
AA Change: A48D
SMART Domains Protein: ENSMUSP00000095236
Gene: ENSMUSG00000073610
AA Change: A48D

DomainStartEndE-ValueType
low complexity region 56 79 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168890
SMART Domains Protein: ENSMUSP00000130297
Gene: ENSMUSG00000042834

DomainStartEndE-ValueType
Pfam:Alveol-reg_P311 1 68 2.6e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171533
SMART Domains Protein: ENSMUSP00000127787
Gene: ENSMUSG00000042834

DomainStartEndE-ValueType
Pfam:Alveol-reg_P311 1 68 2.6e-41 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,851,878 V769A probably damaging Het
Abca4 A G 3: 122,173,662 probably null Het
Ahnak2 A T 12: 112,773,337 S628T probably damaging Het
Ano8 T C 8: 71,483,030 T315A probably damaging Het
Arhgap32 T A 9: 32,248,488 V267E probably benign Het
Asnsd1 A T 1: 53,347,995 S158T probably damaging Het
Asxl2 T A 12: 3,493,758 V309E probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ccdc110 T A 8: 45,941,697 Y208* probably null Het
Cfap157 G T 2: 32,781,396 Q133K probably damaging Het
Cfap53 A G 18: 74,359,606 E467G probably damaging Het
Csmd3 T C 15: 47,820,371 I1688M probably damaging Het
Cyp3a11 A T 5: 145,862,420 L319Q probably damaging Het
Dchs2 A G 3: 83,354,263 I2613V probably benign Het
Dhx35 T A 2: 158,794,919 W11R probably damaging Het
Dscam C T 16: 96,678,425 G1174D probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Greb1l T A 18: 10,501,076 I402K probably benign Het
Hectd3 A T 4: 117,000,624 M585L probably benign Het
Inpp5k T C 11: 75,633,178 probably null Het
Lalba T G 15: 98,480,751 probably null Het
Lgals9 C A 11: 78,971,385 V125L probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Olfr117 A G 17: 37,660,123 I70T possibly damaging Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Rab4b T A 7: 27,172,954 D94V probably damaging Het
Rhpn2 A G 7: 35,372,439 E243G probably benign Het
Rp1 T C 1: 4,345,771 D1706G probably damaging Het
Slc29a3 A T 10: 60,716,026 I413N probably damaging Het
Slc7a9 T C 7: 35,454,639 L229P probably damaging Het
Tenm2 T C 11: 36,864,859 H104R probably benign Het
Tmem87a A G 2: 120,379,750 Y241H probably damaging Het
Trpv5 G T 6: 41,674,668 T192K probably damaging Het
Unc79 T C 12: 103,168,336 V2189A probably damaging Het
Vmn2r106 A C 17: 20,279,099 S183R probably benign Het
Vmn2r112 G T 17: 22,618,235 C559F probably damaging Het
Wdhd1 T C 14: 47,243,867 D1031G possibly damaging Het
Wnt5b T C 6: 119,433,496 S328G probably benign Het
Zcchc7 T C 4: 44,926,032 Y344H probably damaging Het
Other mutations in Gm10549
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02648:Gm10549 APN 18 33464250 unclassified probably benign
R0374:Gm10549 UTSW 18 33464182 unclassified probably benign
R0668:Gm10549 UTSW 18 33470850 missense unknown
R1806:Gm10549 UTSW 18 33470788 missense unknown
R4214:Gm10549 UTSW 18 33464477 splice site probably null
R4826:Gm10549 UTSW 18 33470785 missense unknown
R5747:Gm10549 UTSW 18 33464305 unclassified probably benign
R5748:Gm10549 UTSW 18 33464305 unclassified probably benign
R5766:Gm10549 UTSW 18 33464305 unclassified probably benign
R5796:Gm10549 UTSW 18 33464305 unclassified probably benign
R6101:Gm10549 UTSW 18 33464305 unclassified probably benign
R6129:Gm10549 UTSW 18 33464305 unclassified probably benign
R6130:Gm10549 UTSW 18 33464305 unclassified probably benign
R6218:Gm10549 UTSW 18 33464305 unclassified probably benign
R6219:Gm10549 UTSW 18 33464305 unclassified probably benign
R6220:Gm10549 UTSW 18 33464305 unclassified probably benign
R6283:Gm10549 UTSW 18 33464305 unclassified probably benign
R6298:Gm10549 UTSW 18 33464305 unclassified probably benign
R6299:Gm10549 UTSW 18 33464305 unclassified probably benign
R6309:Gm10549 UTSW 18 33464305 unclassified probably benign
R6321:Gm10549 UTSW 18 33464305 unclassified probably benign
R6322:Gm10549 UTSW 18 33464305 unclassified probably benign
R6327:Gm10549 UTSW 18 33464305 unclassified probably benign
R6337:Gm10549 UTSW 18 33464305 unclassified probably benign
R6420:Gm10549 UTSW 18 33464305 unclassified probably benign
R6492:Gm10549 UTSW 18 33464305 unclassified probably benign
R6494:Gm10549 UTSW 18 33464305 unclassified probably benign
R6505:Gm10549 UTSW 18 33464305 unclassified probably benign
R7173:Gm10549 UTSW 18 33464409 missense unknown
R7724:Gm10549 UTSW 18 33470859 nonsense probably null
R7829:Gm10549 UTSW 18 33464410 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GTAATAATAAACCTGCGGCCG -3'
(R):5'- GGGCTGAGAACTTTGAAAGC -3'

Sequencing Primer
(F):5'- CGGGGCATCTGAGGGAAC -3'
(R):5'- TAGCGTCTCCGGTTGCAC -3'
Posted On2018-05-04