Mutagenetix > Incidental Mutations

Incidental Mutation 'R6406:Lama5'

516289

Institutional Source

Beutler Lab

Gene Symbol

Lama5

Ensembl Gene

ENSMUSG00000015647

Gene Name

laminin, alpha 5

Synonyms

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_001081171.2; MGI: 105382

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6406 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

180176373-180225859 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 180197464 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 750 (C750*)

Ref Sequence

ENSEMBL: ENSMUSP00000015791 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015791]

PDB Structure

LAMININ ALPHA5 CHAIN N-TERMINAL FRAGMENT [X-RAY DIFFRACTION]

Predicted Effect

probably null
Transcript: ENSMUST00000015791
AA Change: C750*

SMART Domains

Protein: ENSMUSP00000015791
Gene: ENSMUSG00000015647
AA Change: C750*

Domain	Start	End	E-Value	Type
signal peptide	1	40	N/A	INTRINSIC
LamNT	44	303	1.06e-132	SMART
EGF_Lam	305	361	4.35e-6	SMART
EGF_Lam	364	431	5.78e-11	SMART
EGF_Lam	434	476	1.32e-5	SMART
EGF_Lam	500	544	8.63e-10	SMART
EGF_Lam	547	590	1.16e-10	SMART
EGF_Lam	593	635	4.63e-10	SMART
EGF_Lam	638	680	6.25e-7	SMART
EGF_Lam	683	726	3.1e-11	SMART
EGF_Lam	730	779	2.99e-4	SMART
EGF_Lam	782	831	4.66e-6	SMART
EGF_Lam	834	878	3.48e-5	SMART
low complexity region	1261	1273	N/A	INTRINSIC
EGF_Lam	1443	1486	7.01e-10	SMART
EGF_like	1489	1530	3.64e-1	SMART
EGF_Lam	1533	1579	8.56e-14	SMART
EGF_Lam	1582	1630	1.86e-14	SMART
LamB	1689	1819	5.86e-61	SMART
EGF_like	1818	1862	2.74e0	SMART
EGF_Lam	1865	1912	3.32e-11	SMART
EGF_Lam	1915	1968	1.61e-9	SMART
EGF_Lam	1971	2022	6.39e-13	SMART
EGF_Lam	2025	2069	1.94e-12	SMART
EGF_Lam	2072	2116	1.35e-11	SMART
EGF_like	2103	2145	3.1e1	SMART
EGF_Lam	2119	2166	1.18e-2	SMART
Pfam:Laminin_I	2189	2453	1.7e-65	PFAM
low complexity region	2532	2548	N/A	INTRINSIC
low complexity region	2557	2569	N/A	INTRINSIC
low complexity region	2632	2641	N/A	INTRINSIC
low complexity region	2663	2676	N/A	INTRINSIC
LamG	2760	2912	3.97e-8	SMART
LamG	2966	3103	1.78e-10	SMART
LamG	3149	3274	1.11e-20	SMART
LamG	3359	3497	4.05e-23	SMART
LamG	3539	3670	3e-26	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

96% (48/50)

MGI Phenotype

Strain: 3624772; 1934917
Lethality: E1-E17
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the vertebrate laminin alpha chains. Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. The protein encoded by this gene is the alpha-5 subunit of of laminin-10 (laminin-511), laminin-11 (laminin-521) and laminin-15 (laminin-523). [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit disrupted basal laminae leading to exencephaly, syndactyly, placentopathy, kidney defects, abnormal lobar septation with absence of a visceral pleural membrane, and lethality in late gestation. [provided by MGI curators]

Allele List at MGI

All alleles(49) : Targeted(5) Gene trapped(44)

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	C	T	17: 45,506,939	P29L	probably benign	Het
Acsm1	A	G	7: 119,662,261	N567S	probably benign	Het
Ahi1	T	G	10: 20,977,049	N505K	probably damaging	Het
Ank2	T	A	3: 127,032,225	D356V	probably damaging	Het
Bhlhe40	TG	TGG	6: 108,664,857		probably null	Het
Bpifb6	C	A	2: 153,904,537	T117K	possibly damaging	Het
C2cd6	T	C	1: 59,058,676	E418G	possibly damaging	Het
Cbx1	A	T	11: 96,801,538	K84*	probably null	Het
Cr2	A	G	1: 195,169,771	L90P	probably damaging	Het
Dclk1	A	G	3: 55,480,406	D91G	probably damaging	Het
Dock1	C	A	7: 135,145,486	Q1509K	probably benign	Het
Fzd1	T	G	5: 4,756,089	T498P	probably damaging	Het
Galnt12	A	G	4: 47,122,534	N271S	probably benign	Het
Gm12888	A	G	4: 121,319,457	I49T	possibly damaging	Het
Gria4	A	T	9: 4,427,077	W788R	probably damaging	Het
Ilf3	C	T	9: 21,396,244	A379V	probably damaging	Het
Islr2	A	G	9: 58,199,980	V43A	probably benign	Het
Jag1	T	A	2: 137,087,643	N782I	probably damaging	Het
Klhl8	T	A	5: 103,863,115	I539F	possibly damaging	Het
Lrrc37a	T	A	11: 103,497,535	T2355S	unknown	Het
Lrrc8a	A	G	2: 30,257,091	H639R	possibly damaging	Het
Map1a	A	T	2: 121,300,743	D442V	probably damaging	Het
Mier3	T	C	13: 111,709,809		probably null	Het
Msantd1	C	A	5: 34,923,321		probably null	Het
Ncapd2	C	A	6: 125,173,878	A785S	probably benign	Het
Ncbp2	CTCGTCTGG	C	16: 31,956,341		probably null	Het
Ncbp2	CGTCTGGATG	CG	16: 31,956,343		probably null	Het
Ndst4	T	C	3: 125,438,501	S240P	probably benign	Het
Nek9	T	C	12: 85,339,172	D17G	probably damaging	Het
Nkx6-1	C	T	5: 101,663,811	A142T	unknown	Het
Nt5dc1	T	C	10: 34,324,408	H205R	probably benign	Het
Olfr1012	T	A	2: 85,760,307	Q23L	possibly damaging	Het
Olfr1442	T	C	19: 12,674,820	I205T	probably benign	Het
Pafah1b1	A	G	11: 74,682,272	M322T	probably benign	Het
Parp2	A	G	14: 50,819,477	N353D	probably benign	Het
Pdcd6ip	T	C	9: 113,674,344	N452S	possibly damaging	Het
Pkd1l2	A	G	8: 117,035,847	V1397A	probably damaging	Het
Prkdc	T	A	16: 15,717,801	L1675Q	probably damaging	Het
Ptprt	T	C	2: 161,553,783	I1157V	probably damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,926		probably benign	Het
Sele	G	T	1: 164,050,743	C217F	probably damaging	Het
Spats1	T	A	17: 45,457,265	H125L	probably damaging	Het
Stard3	T	C	11: 98,378,769	V330A	probably benign	Het
Synj2	T	A	17: 6,019,571		probably benign	Het
Thoc1	T	A	18: 9,977,963	F301L	probably damaging	Het
Thumpd3	G	A	6: 113,055,963	E221K	probably damaging	Het
Trim61	T	C	8: 65,013,725	T295A	possibly damaging	Het
Trp53bp1	T	C	2: 121,270,612	Q35R	probably damaging	Het
Tsnaxip1	C	T	8: 105,843,983	T578I	probably benign	Het

Other mutations in Lama5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01067:Lama5	APN	2	180176543	unclassified	probably benign
IGL01370:Lama5	APN	2	180197400	missense	possibly damaging	0.87
IGL01474:Lama5	APN	2	180196570	missense	probably damaging	1.00
IGL01614:Lama5	APN	2	180180864	missense	probably damaging	1.00
IGL01941:Lama5	APN	2	180192392	missense	possibly damaging	0.71
IGL01953:Lama5	APN	2	180190704	missense	probably damaging	0.97
IGL02093:Lama5	APN	2	180188587	missense	probably damaging	1.00
IGL02197:Lama5	APN	2	180207219	missense	possibly damaging	0.82
IGL02308:Lama5	APN	2	180190327	splice site	probably benign
IGL02314:Lama5	APN	2	180194482	splice site	probably benign
IGL02317:Lama5	APN	2	180191319	missense	probably damaging	1.00
IGL02354:Lama5	APN	2	180193884	nonsense	probably null
IGL02361:Lama5	APN	2	180193884	nonsense	probably null
IGL02557:Lama5	APN	2	180190932	nonsense	probably null
IGL03026:Lama5	APN	2	180195967	missense	probably benign	0.34
IGL03160:Lama5	APN	2	180180335	missense	probably damaging	1.00
IGL03238:Lama5	APN	2	180188574	missense	probably benign
IGL03390:Lama5	APN	2	180207218	missense	probably damaging	1.00
Salty	UTSW	2	180181651	missense	possibly damaging	0.84
PIT4378001:Lama5	UTSW	2	180189445	missense	possibly damaging	0.89
R0003:Lama5	UTSW	2	180178079	splice site	probably null
R0056:Lama5	UTSW	2	180187106	intron	probably benign
R0147:Lama5	UTSW	2	180190406	missense	probably benign
R0148:Lama5	UTSW	2	180190406	missense	probably benign
R0310:Lama5	UTSW	2	180181566	splice site	probably benign
R0326:Lama5	UTSW	2	180182426	missense	possibly damaging	0.90
R0368:Lama5	UTSW	2	180181230	nonsense	probably null
R0479:Lama5	UTSW	2	180184457	missense	probably benign	0.03
R0490:Lama5	UTSW	2	180180169	missense	possibly damaging	0.90
R0636:Lama5	UTSW	2	180189331	critical splice donor site	probably null
R0704:Lama5	UTSW	2	180179484	missense	possibly damaging	0.84
R0733:Lama5	UTSW	2	180180718	missense	possibly damaging	0.83
R1017:Lama5	UTSW	2	180195420	missense	probably damaging	1.00
R1078:Lama5	UTSW	2	180179764	unclassified	probably benign
R1294:Lama5	UTSW	2	180190921	missense	probably benign	0.00
R1423:Lama5	UTSW	2	180195641	missense	probably damaging	1.00
R1438:Lama5	UTSW	2	180182800	missense	probably benign	0.01
R1447:Lama5	UTSW	2	180185878	missense	probably damaging	0.99
R1540:Lama5	UTSW	2	180180151	missense	probably benign
R1601:Lama5	UTSW	2	180197745	missense	probably damaging	1.00
R1624:Lama5	UTSW	2	180206758	missense	probably benign	0.02
R1674:Lama5	UTSW	2	180201987	missense	probably benign	0.00
R1687:Lama5	UTSW	2	180194066	missense	probably benign	0.00
R1696:Lama5	UTSW	2	180202486	missense	probably damaging	1.00
R1701:Lama5	UTSW	2	180221369	missense	probably damaging	1.00
R1778:Lama5	UTSW	2	180195481	splice site	probably benign
R1936:Lama5	UTSW	2	180190921	missense	probably benign	0.00
R1939:Lama5	UTSW	2	180190921	missense	probably benign	0.00
R1940:Lama5	UTSW	2	180190921	missense	probably benign	0.00
R1953:Lama5	UTSW	2	180190747	missense	possibly damaging	0.94
R1966:Lama5	UTSW	2	180188352	missense	probably damaging	1.00
R2024:Lama5	UTSW	2	180179130	missense	probably benign	0.00
R2079:Lama5	UTSW	2	180225508	missense	possibly damaging	0.68
R2115:Lama5	UTSW	2	180186885	missense	probably damaging	1.00
R2173:Lama5	UTSW	2	180196242	missense	probably benign	0.00
R2272:Lama5	UTSW	2	180178603	missense	possibly damaging	0.93
R2357:Lama5	UTSW	2	180180097	missense	probably benign	0.01
R2860:Lama5	UTSW	2	180187247	missense	probably benign	0.00
R2861:Lama5	UTSW	2	180187247	missense	probably benign	0.00
R2939:Lama5	UTSW	2	180198954	missense	probably damaging	1.00
R3053:Lama5	UTSW	2	180183067	missense	probably damaging	0.99
R3430:Lama5	UTSW	2	180196317	missense	probably benign	0.00
R3752:Lama5	UTSW	2	180187222	missense	probably damaging	1.00
R3782:Lama5	UTSW	2	180194563	missense	possibly damaging	0.57
R3901:Lama5	UTSW	2	180182351	splice site	probably benign
R4248:Lama5	UTSW	2	180180427	missense	possibly damaging	0.84
R4626:Lama5	UTSW	2	180184460	missense	probably damaging	0.98
R4638:Lama5	UTSW	2	180190413	missense	possibly damaging	0.89
R4669:Lama5	UTSW	2	180180637	missense	probably damaging	1.00
R4673:Lama5	UTSW	2	180199266	missense	probably damaging	1.00
R4677:Lama5	UTSW	2	180179366	missense	possibly damaging	0.69
R4701:Lama5	UTSW	2	180191696	missense	probably damaging	1.00
R4774:Lama5	UTSW	2	180185941	missense	probably damaging	1.00
R4880:Lama5	UTSW	2	180177068	unclassified	probably benign
R4923:Lama5	UTSW	2	180184149	missense	probably benign	0.18
R4960:Lama5	UTSW	2	180208252	critical splice donor site	probably null
R4983:Lama5	UTSW	2	180193449	missense	probably benign	0.13
R5061:Lama5	UTSW	2	180198786	nonsense	probably null
R5080:Lama5	UTSW	2	180207200	nonsense	probably null
R5135:Lama5	UTSW	2	180202220	missense	possibly damaging	0.89
R5206:Lama5	UTSW	2	180191304	missense	probably damaging	1.00
R5296:Lama5	UTSW	2	180193801	missense	probably damaging	1.00
R5319:Lama5	UTSW	2	180181118	missense	probably damaging	1.00
R5355:Lama5	UTSW	2	180181651	missense	possibly damaging	0.84
R5388:Lama5	UTSW	2	180190746	missense	possibly damaging	0.83
R5528:Lama5	UTSW	2	180194563	missense	probably benign	0.21
R5536:Lama5	UTSW	2	180189349	missense	probably damaging	0.99
R5658:Lama5	UTSW	2	180208276	nonsense	probably null
R5823:Lama5	UTSW	2	180192492	missense	probably benign	0.04
R5885:Lama5	UTSW	2	180201831	missense	probably damaging	1.00
R5889:Lama5	UTSW	2	180193674	intron	probably benign
R5912:Lama5	UTSW	2	180195475	missense	probably damaging	1.00
R5955:Lama5	UTSW	2	180197474	missense	probably damaging	1.00
R6015:Lama5	UTSW	2	180185392	missense	probably benign	0.36
R6037:Lama5	UTSW	2	180207013	missense	probably damaging	1.00
R6037:Lama5	UTSW	2	180207013	missense	probably damaging	1.00
R6191:Lama5	UTSW	2	180180611	missense	probably damaging	0.98
R6191:Lama5	UTSW	2	180185959	missense	probably damaging	1.00
R6359:Lama5	UTSW	2	180195982	missense	probably benign	0.01
R6385:Lama5	UTSW	2	180196533	missense	probably damaging	1.00
R6552:Lama5	UTSW	2	180181154	missense	probably damaging	0.98
R6632:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6633:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6645:Lama5	UTSW	2	180179670	missense	probably damaging	1.00
R6731:Lama5	UTSW	2	180188574	missense	probably benign	0.09
R6744:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6798:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6799:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6801:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6851:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6869:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6881:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6882:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6884:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R7022:Lama5	UTSW	2	180180731	missense	probably damaging	1.00
R7204:Lama5	UTSW	2	180202177	missense	probably damaging	1.00
R7207:Lama5	UTSW	2	180207084	missense	probably damaging	0.98
R7282:Lama5	UTSW	2	180201795	missense	probably damaging	1.00
R7367:Lama5	UTSW	2	180192958	missense	probably benign	0.01
R7410:Lama5	UTSW	2	180202390	critical splice donor site	probably null
R7699:Lama5	UTSW	2	180180861	missense	probably damaging	1.00
R7849:Lama5	UTSW	2	180201812	missense	probably damaging	1.00
R7909:Lama5	UTSW	2	180192276	missense	possibly damaging	0.95
R7948:Lama5	UTSW	2	180202201	missense	probably damaging	1.00
R8153:Lama5	UTSW	2	180187931	missense	probably benign	0.37
R8317:Lama5	UTSW	2	180206991	missense	probably damaging	1.00
R8351:Lama5	UTSW	2	180195608	missense	probably damaging	1.00
R8370:Lama5	UTSW	2	180201487	missense	possibly damaging	0.80
R8398:Lama5	UTSW	2	180197034	critical splice donor site	probably null
R8401:Lama5	UTSW	2	180198787	missense	probably damaging	1.00
R8404:Lama5	UTSW	2	180195222	missense	probably damaging	1.00
R8502:Lama5	UTSW	2	180195222	missense	probably damaging	1.00
RF020:Lama5	UTSW	2	180196178	missense	probably benign
X0065:Lama5	UTSW	2	180181731	missense	probably benign	0.26
Z1177:Lama5	UTSW	2	180183630	missense	probably benign	0.03
Z1177:Lama5	UTSW	2	180189419	missense	probably damaging	1.00
Z1177:Lama5	UTSW	2	180190714	missense	possibly damaging	0.95
Z1177:Lama5	UTSW	2	180198810	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGCAGGATTGAAAGCCCTG -3'
(R):5'- CCATGGTGCAGGATTAGGTAGG -3'

Sequencing Primer
(F):5'- CTGGGGGACAGGATGGG -3'
(R):5'- CCCAGAGAGACCCTGGTTTTTG -3'

Posted On

2018-05-04