Incidental Mutation 'R6406:Tsnaxip1'
ID516306
Institutional Source Beutler Lab
Gene Symbol Tsnaxip1
Ensembl Gene ENSMUSG00000031893
Gene Nametranslin-associated factor X (Tsnax) interacting protein 1
Synonyms1700016K08Rik, TXI1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.509) question?
Stock #R6406 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location105827731-105844680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 105843983 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 578 (T578I)
Ref Sequence ENSEMBL: ENSMUSP00000034365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034365] [ENSMUST00000040776] [ENSMUST00000212431] [ENSMUST00000212566]
Predicted Effect probably benign
Transcript: ENSMUST00000034365
AA Change: T578I

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000034365
Gene: ENSMUSG00000031893
AA Change: T578I

DomainStartEndE-ValueType
Pfam:TSNAXIP1_N 98 209 3.5e-33 PFAM
coiled coil region 304 342 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040776
SMART Domains Protein: ENSMUSP00000038188
Gene: ENSMUSG00000036672

DomainStartEndE-ValueType
Pfam:CENP-T_N 1 374 4.2e-174 PFAM
Pfam:CENP-T_C 404 507 5.4e-36 PFAM
Pfam:CENP-S 424 479 3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211949
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212357
Predicted Effect probably benign
Transcript: ENSMUST00000212431
Predicted Effect probably benign
Transcript: ENSMUST00000212566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212873
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 96% (48/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 C T 17: 45,506,939 P29L probably benign Het
Acsm1 A G 7: 119,662,261 N567S probably benign Het
Ahi1 T G 10: 20,977,049 N505K probably damaging Het
Ank2 T A 3: 127,032,225 D356V probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Bpifb6 C A 2: 153,904,537 T117K possibly damaging Het
C2cd6 T C 1: 59,058,676 E418G possibly damaging Het
Cbx1 A T 11: 96,801,538 K84* probably null Het
Cr2 A G 1: 195,169,771 L90P probably damaging Het
Dclk1 A G 3: 55,480,406 D91G probably damaging Het
Dock1 C A 7: 135,145,486 Q1509K probably benign Het
Fzd1 T G 5: 4,756,089 T498P probably damaging Het
Galnt12 A G 4: 47,122,534 N271S probably benign Het
Gm12888 A G 4: 121,319,457 I49T possibly damaging Het
Gria4 A T 9: 4,427,077 W788R probably damaging Het
Ilf3 C T 9: 21,396,244 A379V probably damaging Het
Islr2 A G 9: 58,199,980 V43A probably benign Het
Jag1 T A 2: 137,087,643 N782I probably damaging Het
Klhl8 T A 5: 103,863,115 I539F possibly damaging Het
Lama5 A T 2: 180,197,464 C750* probably null Het
Lrrc37a T A 11: 103,497,535 T2355S unknown Het
Lrrc8a A G 2: 30,257,091 H639R possibly damaging Het
Map1a A T 2: 121,300,743 D442V probably damaging Het
Mier3 T C 13: 111,709,809 probably null Het
Msantd1 C A 5: 34,923,321 probably null Het
Ncapd2 C A 6: 125,173,878 A785S probably benign Het
Ncbp2 CTCGTCTGG C 16: 31,956,341 probably null Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Ndst4 T C 3: 125,438,501 S240P probably benign Het
Nek9 T C 12: 85,339,172 D17G probably damaging Het
Nkx6-1 C T 5: 101,663,811 A142T unknown Het
Nt5dc1 T C 10: 34,324,408 H205R probably benign Het
Olfr1012 T A 2: 85,760,307 Q23L possibly damaging Het
Olfr1442 T C 19: 12,674,820 I205T probably benign Het
Pafah1b1 A G 11: 74,682,272 M322T probably benign Het
Parp2 A G 14: 50,819,477 N353D probably benign Het
Pdcd6ip T C 9: 113,674,344 N452S possibly damaging Het
Pkd1l2 A G 8: 117,035,847 V1397A probably damaging Het
Prkdc T A 16: 15,717,801 L1675Q probably damaging Het
Ptprt T C 2: 161,553,783 I1157V probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Sele G T 1: 164,050,743 C217F probably damaging Het
Spats1 T A 17: 45,457,265 H125L probably damaging Het
Stard3 T C 11: 98,378,769 V330A probably benign Het
Synj2 T A 17: 6,019,571 probably benign Het
Thoc1 T A 18: 9,977,963 F301L probably damaging Het
Thumpd3 G A 6: 113,055,963 E221K probably damaging Het
Trim61 T C 8: 65,013,725 T295A possibly damaging Het
Trp53bp1 T C 2: 121,270,612 Q35R probably damaging Het
Other mutations in Tsnaxip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Tsnaxip1 APN 8 105841423 missense probably benign 0.04
IGL00490:Tsnaxip1 APN 8 105842184 missense probably damaging 1.00
IGL00849:Tsnaxip1 APN 8 105842168 missense probably damaging 0.99
IGL01756:Tsnaxip1 APN 8 105842788 splice site probably benign
IGL01821:Tsnaxip1 APN 8 105837516 missense probably damaging 0.96
IGL02278:Tsnaxip1 APN 8 105827781 utr 5 prime probably benign
IGL02290:Tsnaxip1 APN 8 105833487 missense probably benign 0.00
IGL02980:Tsnaxip1 UTSW 8 105842210 missense probably damaging 0.96
R0239:Tsnaxip1 UTSW 8 105844488 missense possibly damaging 0.96
R0239:Tsnaxip1 UTSW 8 105844488 missense possibly damaging 0.96
R1544:Tsnaxip1 UTSW 8 105827751 start gained probably benign
R1939:Tsnaxip1 UTSW 8 105840038 missense probably benign 0.04
R3024:Tsnaxip1 UTSW 8 105841743 missense probably damaging 1.00
R3695:Tsnaxip1 UTSW 8 105833535 missense possibly damaging 0.61
R3853:Tsnaxip1 UTSW 8 105840701 splice site probably benign
R4044:Tsnaxip1 UTSW 8 105833545 splice site probably null
R4376:Tsnaxip1 UTSW 8 105841801 nonsense probably null
R4627:Tsnaxip1 UTSW 8 105841407 missense probably damaging 1.00
R4790:Tsnaxip1 UTSW 8 105833523 missense probably benign 0.12
R5806:Tsnaxip1 UTSW 8 105837496 missense possibly damaging 0.83
R5814:Tsnaxip1 UTSW 8 105843971 missense probably benign 0.00
R6045:Tsnaxip1 UTSW 8 105844187 missense probably benign 0.24
R6374:Tsnaxip1 UTSW 8 105841540 missense possibly damaging 0.55
R7915:Tsnaxip1 UTSW 8 105842781 missense possibly damaging 0.88
R7918:Tsnaxip1 UTSW 8 105844535 missense probably benign 0.00
R8317:Tsnaxip1 UTSW 8 105827806 missense probably benign 0.07
R8377:Tsnaxip1 UTSW 8 105842547 missense probably damaging 1.00
R8534:Tsnaxip1 UTSW 8 105838738 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATCATTATGAGTTCAAGGACTCTC -3'
(R):5'- ACAGCCTCTGCACAAATGGC -3'

Sequencing Primer
(F):5'- GTGGCTCACAACCATCTGTAATGG -3'
(R):5'- TGCACAAATGGCTCACTCTG -3'
Posted On2018-05-04