Incidental Mutation 'R6406:Stard3'
ID516316
Institutional Source Beutler Lab
Gene Symbol Stard3
Ensembl Gene ENSMUSG00000018167
Gene NameSTART domain containing 3
Synonymses64, Mln64
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6406 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location98358368-98381112 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98378769 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 330 (V330A)
Ref Sequence ENSEMBL: ENSMUSP00000018311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018311]
Predicted Effect probably benign
Transcript: ENSMUST00000018311
AA Change: V330A

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000018311
Gene: ENSMUSG00000018167
AA Change: V330A

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
Pfam:MENTAL 48 214 1.1e-65 PFAM
START 240 445 4.43e-67 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155063
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of lipid trafficking proteins that are characterized by a C-terminal steroidogenic acute regulatory domain and an N-terminal metastatic lymph node 64 domain. The encoded protein localizes to the membranes of late endosomes and may be involved in exporting cholesterol. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a truncated allele are viable and fertile and display mild defects in cholesterol metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 C T 17: 45,506,939 P29L probably benign Het
Acsm1 A G 7: 119,662,261 N567S probably benign Het
Ahi1 T G 10: 20,977,049 N505K probably damaging Het
Ank2 T A 3: 127,032,225 D356V probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Bpifb6 C A 2: 153,904,537 T117K possibly damaging Het
C2cd6 T C 1: 59,058,676 E418G possibly damaging Het
Cbx1 A T 11: 96,801,538 K84* probably null Het
Cr2 A G 1: 195,169,771 L90P probably damaging Het
Dclk1 A G 3: 55,480,406 D91G probably damaging Het
Dock1 C A 7: 135,145,486 Q1509K probably benign Het
Fzd1 T G 5: 4,756,089 T498P probably damaging Het
Galnt12 A G 4: 47,122,534 N271S probably benign Het
Gm12888 A G 4: 121,319,457 I49T possibly damaging Het
Gria4 A T 9: 4,427,077 W788R probably damaging Het
Ilf3 C T 9: 21,396,244 A379V probably damaging Het
Islr2 A G 9: 58,199,980 V43A probably benign Het
Jag1 T A 2: 137,087,643 N782I probably damaging Het
Klhl8 T A 5: 103,863,115 I539F possibly damaging Het
Lama5 A T 2: 180,197,464 C750* probably null Het
Lrrc37a T A 11: 103,497,535 T2355S unknown Het
Lrrc8a A G 2: 30,257,091 H639R possibly damaging Het
Map1a A T 2: 121,300,743 D442V probably damaging Het
Mier3 T C 13: 111,709,809 probably null Het
Msantd1 C A 5: 34,923,321 probably null Het
Ncapd2 C A 6: 125,173,878 A785S probably benign Het
Ncbp2 CTCGTCTGG C 16: 31,956,341 probably null Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Ndst4 T C 3: 125,438,501 S240P probably benign Het
Nek9 T C 12: 85,339,172 D17G probably damaging Het
Nkx6-1 C T 5: 101,663,811 A142T unknown Het
Nt5dc1 T C 10: 34,324,408 H205R probably benign Het
Olfr1012 T A 2: 85,760,307 Q23L possibly damaging Het
Olfr1442 T C 19: 12,674,820 I205T probably benign Het
Pafah1b1 A G 11: 74,682,272 M322T probably benign Het
Parp2 A G 14: 50,819,477 N353D probably benign Het
Pdcd6ip T C 9: 113,674,344 N452S possibly damaging Het
Pkd1l2 A G 8: 117,035,847 V1397A probably damaging Het
Prkdc T A 16: 15,717,801 L1675Q probably damaging Het
Ptprt T C 2: 161,553,783 I1157V probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Sele G T 1: 164,050,743 C217F probably damaging Het
Spats1 T A 17: 45,457,265 H125L probably damaging Het
Synj2 T A 17: 6,019,571 probably benign Het
Thoc1 T A 18: 9,977,963 F301L probably damaging Het
Thumpd3 G A 6: 113,055,963 E221K probably damaging Het
Trim61 T C 8: 65,013,725 T295A possibly damaging Het
Trp53bp1 T C 2: 121,270,612 Q35R probably damaging Het
Tsnaxip1 C T 8: 105,843,983 T578I probably benign Het
Other mutations in Stard3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Stard3 APN 11 98377459 missense probably damaging 0.99
IGL00498:Stard3 APN 11 98376530 missense possibly damaging 0.90
IGL01652:Stard3 APN 11 98378733 splice site probably benign
IGL02553:Stard3 APN 11 98376563 missense possibly damaging 0.55
IGL03160:Stard3 APN 11 98378911 missense probably damaging 1.00
R0508:Stard3 UTSW 11 98372314 missense probably damaging 0.99
R1619:Stard3 UTSW 11 98376609 critical splice donor site probably null
R4781:Stard3 UTSW 11 98372334 missense possibly damaging 0.91
R5889:Stard3 UTSW 11 98375535 missense probably benign 0.13
R6117:Stard3 UTSW 11 98372262 missense probably damaging 1.00
R7290:Stard3 UTSW 11 98378219 critical splice donor site probably null
R7719:Stard3 UTSW 11 98375676 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GTGCTTACCTTGTACCCAGC -3'
(R):5'- ACCTGACATATTTGTGCGTGGG -3'

Sequencing Primer
(F):5'- CCTGGGCCTGCAGGGAG -3'
(R):5'- CAATGCCGGATGACAGGTATC -3'
Posted On2018-05-04