Mutagenetix > Incidental Mutation

Incidental Mutation 'R6451:Tmc2'

516332

Institutional Source

Beutler Lab

Gene Symbol

Tmc2

Ensembl Gene

ENSMUSG00000060332

Gene Name

transmembrane channel-like gene family 2

Synonyms

MMRRC Submission

044587-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.375) question?

Stock #

R6451 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

130195194-130264445 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 130264203 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 885 (R885G)

Ref Sequence

ENSEMBL: ENSMUSP00000125843 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077988] [ENSMUST00000166774]

AlphaFold

Q8R4P4

Predicted Effect

probably damaging
Transcript: ENSMUST00000077988
AA Change: R885G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000077139
Gene: ENSMUSG00000060332
AA Change: R885G

Domain	Start	End	E-Value	Type
transmembrane domain	236	258	N/A	INTRINSIC
transmembrane domain	317	339	N/A	INTRINSIC
transmembrane domain	412	434	N/A	INTRINSIC
transmembrane domain	488	507	N/A	INTRINSIC
low complexity region	541	553	N/A	INTRINSIC
Pfam:TMC	556	671	8.6e-41	PFAM
transmembrane domain	676	698	N/A	INTRINSIC
transmembrane domain	735	757	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000166774
AA Change: R885G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000125843
Gene: ENSMUSG00000060332
AA Change: R885G

Domain	Start	End	E-Value	Type
transmembrane domain	236	258	N/A	INTRINSIC
transmembrane domain	317	339	N/A	INTRINSIC
transmembrane domain	412	434	N/A	INTRINSIC
transmembrane domain	488	507	N/A	INTRINSIC
low complexity region	541	553	N/A	INTRINSIC
Pfam:TMC	556	671	1.2e-36	PFAM
transmembrane domain	676	698	N/A	INTRINSIC
transmembrane domain	735	757	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 93.9%

Validation Efficiency

98% (39/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is necesssary for mechanotransduction in cochlear hair cells of the inner ear. Mutations in this gene may underlie hereditary disorders of balance and hearing. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele display normal hearing and motor behavior. Cochlear hair cells show partial resistance to gentamicin induced toxicity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca7	T	A	10: 80,006,899	V1164E	probably damaging	Het
Acnat2	A	G	4: 49,380,262	V372A	probably benign	Het
Adam17	A	T	12: 21,342,882	D313E	probably benign	Het
Adgrf5	A	T	17: 43,424,818	R200*	probably null	Het
Akr1d1	G	A	6: 37,550,215	E129K	probably benign	Het
Arhgap29	T	A	3: 121,993,581	V382E	probably damaging	Het
Arhgef40	G	A	14: 52,000,999	V1312I	probably damaging	Het
Bbs9	A	G	9: 22,567,764	S168G	probably damaging	Het
Carmil1	T	A	13: 24,092,558	K202*	probably null	Het
Cnep1r1	A	G	8: 88,119,810	E19G	probably damaging	Het
Dnah1	T	A	14: 31,300,808	Q1124L	probably benign	Het
Dph1	G	T	11: 75,181,317	A242D	probably damaging	Het
Efcab7	T	A	4: 99,831,501	Y73*	probably null	Het
Esp18	G	T	17: 39,409,962	E33*	probably null	Het
Fbln2	T	A	6: 91,234,259	I395K	probably benign	Het
Gm15922	C	G	7: 3,737,320	A301P	probably damaging	Het
Grin3a	C	T	4: 49,844,969	C38Y	probably damaging	Het
Hivep3	T	A	4: 120,098,908	S1474T	probably benign	Het
Hmcn1	C	T	1: 150,992,919	V45M	probably damaging	Het
Intu	T	A	3: 40,701,293	F937I	possibly damaging	Het
Llgl2	G	A	11: 115,844,941	G121D	probably damaging	Het
Myo7a	C	T	7: 98,073,167	V1184M	probably benign	Het
Nsmce4a	G	T	7: 130,542,749			Het
Olfr1153	T	C	2: 87,896,591	Y131H	probably damaging	Het
Olfr822	A	T	10: 130,075,138	M243L	probably benign	Het
Phactr1	T	A	13: 43,132,993	V590E	probably damaging	Het
Pigo	G	A	4: 43,021,412	S510L	probably benign	Het
Rnf19a	A	G	15: 36,253,059	I378T	possibly damaging	Het
Rnf216	G	T	5: 142,992,834	P793T	possibly damaging	Het
Samd8	T	C	14: 21,783,798		probably null	Het
Son	T	A	16: 91,657,602	M1079K	probably damaging	Het
Spata7	T	A	12: 98,658,337	M166K	probably benign	Het
Spta1	G	A	1: 174,217,201	E1468K	probably damaging	Het
Taar3	A	T	10: 23,949,807	I84F	possibly damaging	Het
Tas2r107	T	A	6: 131,660,014	D24V	possibly damaging	Het
Tox3	C	A	8: 90,258,059	R164L	probably benign	Het
Ttc5	A	G	14: 50,767,207	I380T	probably damaging	Het
Vmn1r179	A	G	7: 23,928,651	N89S	possibly damaging	Het
Zfp944	T	C	17: 22,338,865	E467G	probably benign	Het
Zzef1	A	T	11: 72,923,156	D2857V	possibly damaging	Het

Other mutations in Tmc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Tmc2	APN	2	130261304	missense	possibly damaging	0.94
IGL00966:Tmc2	APN	2	130264012	missense	probably benign	0.02
IGL01094:Tmc2	APN	2	130260166	splice site	probably benign
IGL01331:Tmc2	APN	2	130232356	missense	probably damaging	1.00
IGL01660:Tmc2	APN	2	130260224	nonsense	probably null
IGL01926:Tmc2	APN	2	130260240	missense	possibly damaging	0.68
IGL02150:Tmc2	APN	2	130240153	missense	probably damaging	0.98
IGL02273:Tmc2	APN	2	130229206	missense	probably damaging	0.99
IGL03137:Tmc2	APN	2	130240130	missense	probably damaging	1.00
IGL03179:Tmc2	APN	2	130229187	missense	probably damaging	1.00
FR4449:Tmc2	UTSW	2	130240196	missense	probably damaging	1.00
H8786:Tmc2	UTSW	2	130226262	missense	probably damaging	1.00
PIT4418001:Tmc2	UTSW	2	130248651	missense	probably damaging	0.96
R0364:Tmc2	UTSW	2	130202103	missense	probably benign	0.00
R1183:Tmc2	UTSW	2	130247976	missense	probably damaging	1.00
R1446:Tmc2	UTSW	2	130248730	missense	probably damaging	0.97
R1458:Tmc2	UTSW	2	130248762	missense	probably damaging	1.00
R1589:Tmc2	UTSW	2	130247960	missense	probably damaging	0.99
R1656:Tmc2	UTSW	2	130247934	missense	possibly damaging	0.93
R1686:Tmc2	UTSW	2	130256116	missense	possibly damaging	0.71
R1765:Tmc2	UTSW	2	130260225	missense	probably benign	0.34
R1776:Tmc2	UTSW	2	130234869	missense	probably damaging	1.00
R1873:Tmc2	UTSW	2	130248756	missense	possibly damaging	0.68
R1972:Tmc2	UTSW	2	130214664	splice site	probably benign
R2020:Tmc2	UTSW	2	130232385	missense	probably damaging	1.00
R2208:Tmc2	UTSW	2	130214563	splice site	probably null
R3968:Tmc2	UTSW	2	130202071	missense	probably benign	0.02
R4732:Tmc2	UTSW	2	130261397	splice site	probably null
R4733:Tmc2	UTSW	2	130261397	splice site	probably null
R4989:Tmc2	UTSW	2	130202041	missense	possibly damaging	0.88
R5143:Tmc2	UTSW	2	130234818	missense	probably damaging	0.98
R5411:Tmc2	UTSW	2	130240115	missense	probably damaging	1.00
R5514:Tmc2	UTSW	2	130241644	missense	possibly damaging	0.94
R5690:Tmc2	UTSW	2	130232386	missense	probably damaging	1.00
R5983:Tmc2	UTSW	2	130247976	missense	probably damaging	1.00
R6927:Tmc2	UTSW	2	130261380	missense	probably benign
R7132:Tmc2	UTSW	2	130232409	missense	possibly damaging	0.82
R7240:Tmc2	UTSW	2	130234804	missense	possibly damaging	0.80
R7353:Tmc2	UTSW	2	130196577	critical splice donor site	probably null
R8167:Tmc2	UTSW	2	130241568	missense	probably benign	0.04
R8554:Tmc2	UTSW	2	130264164	missense	probably benign	0.00
R9134:Tmc2	UTSW	2	130232401	missense	probably benign	0.21
R9169:Tmc2	UTSW	2	130241596	missense	probably damaging	1.00
R9209:Tmc2	UTSW	2	130261397	splice site	probably null
R9232:Tmc2	UTSW	2	130243129	missense	probably damaging	1.00
R9725:Tmc2	UTSW	2	130247961	missense	probably damaging	0.99
X0019:Tmc2	UTSW	2	130208285	missense	possibly damaging	0.59
X0052:Tmc2	UTSW	2	130201972	missense	probably benign	0.00
Z1177:Tmc2	UTSW	2	130208296	missense	possibly damaging	0.56

Predicted Primers

PCR Primer
(F):5'- GCCCAGAAAGTTCCGATTGG -3'
(R):5'- AACCGCTAGTGTGTGAGGTC -3'

Sequencing Primer
(F):5'- TCCGATTGGAACACAGACG -3'
(R):5'- GTGTGAGGTCCATTGCTCTTCC -3'

Posted On

2018-05-21