Incidental Mutation 'R6451:Tas2r107'
ID516343
Institutional Source Beutler Lab
Gene Symbol Tas2r107
Ensembl Gene ENSMUSG00000053389
Gene Nametaste receptor, type 2, member 107
SynonymsT2R4, Tas2r7, mGR06, STC 5-1, mt2r43, T2R07
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R6451 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location131659118-131660149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 131660014 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 24 (D24V)
Ref Sequence ENSEMBL: ENSMUSP00000067082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065781]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065781
AA Change: D24V

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000067082
Gene: ENSMUSG00000053389
AA Change: D24V

DomainStartEndE-ValueType
Pfam:TAS2R 1 297 4e-106 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 80,006,899 V1164E probably damaging Het
Acnat2 A G 4: 49,380,262 V372A probably benign Het
Adam17 A T 12: 21,342,882 D313E probably benign Het
Adgrf5 A T 17: 43,424,818 R200* probably null Het
Akr1d1 G A 6: 37,550,215 E129K probably benign Het
Arhgap29 T A 3: 121,993,581 V382E probably damaging Het
Arhgef40 G A 14: 52,000,999 V1312I probably damaging Het
Bbs9 A G 9: 22,567,764 S168G probably damaging Het
Carmil1 T A 13: 24,092,558 K202* probably null Het
Cnep1r1 A G 8: 88,119,810 E19G probably damaging Het
Dnah1 T A 14: 31,300,808 Q1124L probably benign Het
Dph1 G T 11: 75,181,317 A242D probably damaging Het
Efcab7 T A 4: 99,831,501 Y73* probably null Het
Esp18 G T 17: 39,409,962 E33* probably null Het
Fbln2 T A 6: 91,234,259 I395K probably benign Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Grin3a C T 4: 49,844,969 C38Y probably damaging Het
Hivep3 T A 4: 120,098,908 S1474T probably benign Het
Hmcn1 C T 1: 150,992,919 V45M probably damaging Het
Intu T A 3: 40,701,293 F937I possibly damaging Het
Llgl2 G A 11: 115,844,941 G121D probably damaging Het
Myo7a C T 7: 98,073,167 V1184M probably benign Het
Nsmce4a G T 7: 130,542,749 Het
Olfr1153 T C 2: 87,896,591 Y131H probably damaging Het
Olfr822 A T 10: 130,075,138 M243L probably benign Het
Phactr1 T A 13: 43,132,993 V590E probably damaging Het
Pigo G A 4: 43,021,412 S510L probably benign Het
Rnf19a A G 15: 36,253,059 I378T possibly damaging Het
Rnf216 G T 5: 142,992,834 P793T possibly damaging Het
Samd8 T C 14: 21,783,798 probably null Het
Son T A 16: 91,657,602 M1079K probably damaging Het
Spata7 T A 12: 98,658,337 M166K probably benign Het
Spta1 G A 1: 174,217,201 E1468K probably damaging Het
Taar3 A T 10: 23,949,807 I84F possibly damaging Het
Tmc2 A G 2: 130,264,203 R885G probably damaging Het
Tox3 C A 8: 90,258,059 R164L probably benign Het
Ttc5 A G 14: 50,767,207 I380T probably damaging Het
Vmn1r179 A G 7: 23,928,651 N89S possibly damaging Het
Zfp944 T C 17: 22,338,865 E467G probably benign Het
Zzef1 A T 11: 72,923,156 D2857V possibly damaging Het
Other mutations in Tas2r107
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02749:Tas2r107 APN 6 131659954 missense probably damaging 1.00
IGL02751:Tas2r107 APN 6 131659484 missense probably damaging 1.00
IGL02868:Tas2r107 APN 6 131659286 missense probably benign 0.11
IGL02943:Tas2r107 APN 6 131659406 missense probably damaging 0.99
R1564:Tas2r107 UTSW 6 131659822 missense probably damaging 0.96
R1905:Tas2r107 UTSW 6 131659988 missense probably benign 0.20
R1906:Tas2r107 UTSW 6 131659988 missense probably benign 0.20
R1907:Tas2r107 UTSW 6 131659988 missense probably benign 0.20
R2185:Tas2r107 UTSW 6 131659603 missense probably damaging 0.98
R3014:Tas2r107 UTSW 6 131660009 missense probably benign 0.30
R3824:Tas2r107 UTSW 6 131659330 missense probably benign 0.00
R4465:Tas2r107 UTSW 6 131660009 missense probably benign 0.30
R5058:Tas2r107 UTSW 6 131659742 missense probably damaging 1.00
R5646:Tas2r107 UTSW 6 131659708 missense probably benign 0.02
R5975:Tas2r107 UTSW 6 131659780 missense probably benign 0.02
R6008:Tas2r107 UTSW 6 131659912 missense possibly damaging 0.82
R6144:Tas2r107 UTSW 6 131660003 missense possibly damaging 0.87
R6662:Tas2r107 UTSW 6 131659489 missense possibly damaging 0.82
R6702:Tas2r107 UTSW 6 131659384 missense probably benign 0.12
R7032:Tas2r107 UTSW 6 131659190 missense possibly damaging 0.62
R7635:Tas2r107 UTSW 6 131659600 missense possibly damaging 0.92
R8303:Tas2r107 UTSW 6 131659622 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGTTATGTTTCCAGAGGTAAGCATG -3'
(R):5'- CTGAATCTATCACATGACAATAGGC -3'

Sequencing Primer
(F):5'- TCCAGAGGTAAGCATGTGTGG -3'
(R):5'- TCACATGACAATAGGCTTGAAAAG -3'
Posted On2018-05-21