Incidental Mutation 'R6472:Wnt3'
ID516389
Institutional Source Beutler Lab
Gene Symbol Wnt3
Ensembl Gene ENSMUSG00000000125
Gene Namewingless-type MMTV integration site family, member 3
SynonymsInt-4, Wnt-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6472 (G1)
Quality Score220.009
Status Validated
Chromosome11
Chromosomal Location103774150-103817957 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 103808274 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 69 (V69I)
Ref Sequence ENSEMBL: ENSMUSP00000000127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000127]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000127
AA Change: V69I

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000000127
Gene: ENSMUSG00000000125
AA Change: V69I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
WNT1 47 355 1.24e-216 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.3%
  • 20x: 94.4%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 98% amino acid identity to mouse Wnt3 protein, and 84% to human WNT3A protein, another WNT gene product. The mouse studies show the requirement of Wnt3 in primary axis formation in the mouse. Studies of the gene expression suggest that this gene may play a key role in some cases of human breast, rectal, lung, and gastric cancer through activation of the WNT-beta-catenin-TCF signaling pathway. This gene is clustered with WNT15, another family member, in the chromosome 17q21 region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants develop to the egg cylinder stage, but fail to form a primitive streak, mesoderm, or node, and die by embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik A T 16: 91,056,003 S82T probably benign Het
Abca1 A G 4: 53,085,991 probably null Het
Ascc3 T C 10: 50,720,687 Y1238H probably benign Het
BC003331 C T 1: 150,381,522 D230N probably benign Het
Cdadc1 T C 14: 59,586,042 T334A probably damaging Het
Csrp3 G A 7: 48,835,608 T47I possibly damaging Het
Cyp2f2 G A 7: 27,129,224 R173H probably damaging Het
Fads6 T C 11: 115,286,136 T165A probably damaging Het
Fbxo30 T C 10: 11,291,231 S566P probably damaging Het
Gsn A G 2: 35,290,451 probably null Het
Heatr1 A G 13: 12,434,230 D1897G probably benign Het
Il2ra G A 2: 11,681,969 E204K possibly damaging Het
Kif16b G T 2: 142,699,948 probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Nov A T 15: 54,749,272 T226S possibly damaging Het
Olfr223 G A 11: 59,589,756 T111I probably benign Het
Olfr228 A T 2: 86,483,190 L184* probably null Het
Olfr434 A G 6: 43,217,359 I149V probably benign Het
Olfr837 T A 9: 19,137,415 C141S probably damaging Het
Pappa2 T C 1: 158,834,799 D1202G probably damaging Het
Pcp4l1 A T 1: 171,174,435 I52N possibly damaging Het
Sis C T 3: 72,938,734 W665* probably null Het
Smap2 GACTCTAC GAC 4: 120,973,085 probably benign Het
Snrpb2 A G 2: 143,068,301 K93R possibly damaging Het
Syt10 T G 15: 89,814,558 E194D probably benign Het
Tmem163 A C 1: 127,495,734 F264V probably benign Het
Trav3-1 G T 14: 52,581,050 E60D possibly damaging Het
Vmn1r237 G A 17: 21,314,354 S113N probably benign Het
Vwa8 T C 14: 79,009,170 S651P possibly damaging Het
Other mutations in Wnt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Wnt3 APN 11 103808314 missense possibly damaging 0.81
IGL01645:Wnt3 APN 11 103812378 missense probably benign 0.00
IGL01989:Wnt3 APN 11 103812407 missense probably benign 0.44
IGL02087:Wnt3 APN 11 103812359 missense probably benign 0.34
IGL02525:Wnt3 APN 11 103812470 missense probably damaging 1.00
R0494:Wnt3 UTSW 11 103812315 missense probably damaging 1.00
R0615:Wnt3 UTSW 11 103812381 missense possibly damaging 0.68
R1438:Wnt3 UTSW 11 103808251 missense probably damaging 1.00
R2058:Wnt3 UTSW 11 103812285 missense probably damaging 0.97
R2127:Wnt3 UTSW 11 103812648 missense possibly damaging 0.82
R2128:Wnt3 UTSW 11 103812648 missense possibly damaging 0.82
R4470:Wnt3 UTSW 11 103812624 missense probably damaging 0.99
R4878:Wnt3 UTSW 11 103808205 missense possibly damaging 0.88
R5616:Wnt3 UTSW 11 103812770 critical splice donor site probably null
R6052:Wnt3 UTSW 11 103808174 nonsense probably null
R6687:Wnt3 UTSW 11 103812585 missense probably damaging 1.00
R7652:Wnt3 UTSW 11 103812464 missense possibly damaging 0.83
R7760:Wnt3 UTSW 11 103811440 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTAGGCCACGTGTTCTGTG -3'
(R):5'- AACTTGGACTCAGGGTTTCC -3'

Sequencing Primer
(F):5'- AGGCCACGTGTTCTGTGTCTAC -3'
(R):5'- AGGGTCCCAGAACCCTTC -3'
Posted On2018-05-21