Incidental Mutation 'R6468:Vash2'
ID 516402
Institutional Source Beutler Lab
Gene Symbol Vash2
Ensembl Gene ENSMUSG00000037568
Gene Name vasohibin 2
Synonyms B130052G07Rik
MMRRC Submission 044601-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R6468 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 190679843-190711493 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 190710484 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 57 (P57L)
Ref Sequence ENSEMBL: ENSMUSP00000127626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047409] [ENSMUST00000166139]
AlphaFold Q8C5G2
Predicted Effect probably damaging
Transcript: ENSMUST00000047409
AA Change: P57L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036768
Gene: ENSMUSG00000037568
AA Change: P57L

DomainStartEndE-ValueType
Pfam:Vasohibin 45 291 7e-124 PFAM
low complexity region 312 329 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166139
AA Change: P57L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127626
Gene: ENSMUSG00000037568
AA Change: P57L

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
Pfam:Vasohibin 47 291 1.1e-124 PFAM
low complexity region 312 329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192306
Meta Mutation Damage Score 0.9011 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 97% (57/59)
MGI Phenotype PHENOTYPE: Homozygous null mice have defects in initiating angiogenesis in response to skin wounding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 A G 10: 80,177,747 (GRCm39) V305A possibly damaging Het
Adgrl4 A G 3: 151,198,012 (GRCm39) T91A probably benign Het
Ano6 A G 15: 95,865,595 (GRCm39) I860V probably benign Het
B3galnt1 A G 3: 69,482,866 (GRCm39) S132P probably damaging Het
Bltp1 T C 3: 37,062,592 (GRCm39) I3368T probably damaging Het
Btbd10 A T 7: 112,946,266 (GRCm39) V33E probably benign Het
Cacna1g A T 11: 94,330,548 (GRCm39) V989D probably damaging Het
Celsr3 A G 9: 108,712,989 (GRCm39) D1807G probably benign Het
Chd6 A G 2: 160,854,987 (GRCm39) M807T probably damaging Het
Cpxm2 T C 7: 131,672,589 (GRCm39) D320G probably damaging Het
Cryzl1 A C 16: 91,489,413 (GRCm39) probably null Het
Dcbld2 A T 16: 58,253,736 (GRCm39) K158* probably null Het
Depdc5 A G 5: 33,069,575 (GRCm39) N437S probably benign Het
Dock7 G A 4: 98,855,464 (GRCm39) S1496L probably benign Het
Eea1 T G 10: 95,864,274 (GRCm39) I931R probably benign Het
Eif2ak4 C A 2: 118,266,722 (GRCm39) L714I probably damaging Het
Enpep A G 3: 129,125,509 (GRCm39) probably null Het
Fam83b T A 9: 76,409,413 (GRCm39) K238* probably null Het
Fam83f A G 15: 80,576,312 (GRCm39) Y321C possibly damaging Het
Fanci A G 7: 79,067,687 (GRCm39) I42V probably benign Het
Flg2 A T 3: 93,121,728 (GRCm39) R1299S unknown Het
Gak G T 5: 108,771,202 (GRCm39) C102* probably null Het
Gcnt7 A G 2: 172,295,993 (GRCm39) L277P probably damaging Het
Gucy2d A G 7: 98,099,168 (GRCm39) E329G probably benign Het
Hacd1 T C 2: 14,040,755 (GRCm39) I167V probably damaging Het
Hdlbp T A 1: 93,345,389 (GRCm39) D662V possibly damaging Het
Hspa4 A T 11: 53,155,883 (GRCm39) V674E probably benign Het
Hunk A G 16: 90,290,320 (GRCm39) Q442R possibly damaging Het
Lce1j A T 3: 92,696,729 (GRCm39) C16* probably null Het
Lrat A T 3: 82,810,799 (GRCm39) M74K probably damaging Het
Lrig2 G A 3: 104,374,509 (GRCm39) R191C probably damaging Het
Lrrc37a A C 11: 103,351,666 (GRCm39) F2558L unknown Het
Mctp1 T A 13: 76,879,930 (GRCm39) probably null Het
Mecom T A 3: 30,194,535 (GRCm39) probably benign Het
Mgst1 A G 6: 138,118,585 (GRCm39) probably null Het
Ms4a15 T G 19: 10,970,534 (GRCm39) E3A probably benign Het
Myo1d T C 11: 80,448,300 (GRCm39) I942V probably benign Het
Neu2 A G 1: 87,524,600 (GRCm39) Y195C probably damaging Het
Nipa1 A T 7: 55,669,252 (GRCm39) V22E probably benign Het
Or4n4b A T 14: 50,535,924 (GRCm39) L281I probably benign Het
Or6c35 T C 10: 129,169,580 (GRCm39) S277P possibly damaging Het
Or8k25 T A 2: 86,244,381 (GRCm39) N5I probably damaging Het
Pik3r4 A G 9: 105,562,389 (GRCm39) T1223A possibly damaging Het
Ppl T C 16: 4,910,305 (GRCm39) D811G probably damaging Het
Prep T A 10: 44,991,203 (GRCm39) Y290N probably damaging Het
Ptk6 A T 2: 180,840,895 (GRCm39) H215Q probably benign Het
Rad50 A G 11: 53,582,971 (GRCm39) I474T possibly damaging Het
Rnf213 T A 11: 119,343,513 (GRCm39) V3626E possibly damaging Het
Scn4a C T 11: 106,236,502 (GRCm39) V253M probably damaging Het
Snta1 T A 2: 154,219,069 (GRCm39) D422V probably damaging Het
Spata31h1 G T 10: 82,131,150 (GRCm39) T620K probably benign Het
Stk38 A G 17: 29,203,086 (GRCm39) L160P probably benign Het
Tapbp T C 17: 34,145,072 (GRCm39) F323S probably damaging Het
Uggt1 C T 1: 36,212,531 (GRCm39) R937Q probably benign Het
Vmn1r4 G A 6: 56,933,852 (GRCm39) V119I probably benign Het
Vmn2r74 T C 7: 85,610,599 (GRCm39) D31G probably benign Het
Zfp114 T C 7: 23,877,206 (GRCm39) V16A possibly damaging Het
Other mutations in Vash2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02345:Vash2 APN 1 190,710,412 (GRCm39) missense probably benign 0.15
Logical UTSW 1 190,692,422 (GRCm39) missense probably benign 0.11
R0507:Vash2 UTSW 1 190,699,115 (GRCm39) splice site probably benign
R2265:Vash2 UTSW 1 190,682,410 (GRCm39) missense probably damaging 0.97
R3615:Vash2 UTSW 1 190,702,616 (GRCm39) missense probably damaging 1.00
R3616:Vash2 UTSW 1 190,702,616 (GRCm39) missense probably damaging 1.00
R4610:Vash2 UTSW 1 190,692,498 (GRCm39) missense probably benign 0.04
R4844:Vash2 UTSW 1 190,710,691 (GRCm39) utr 5 prime probably benign
R5569:Vash2 UTSW 1 190,692,488 (GRCm39) missense possibly damaging 0.65
R6282:Vash2 UTSW 1 190,692,422 (GRCm39) missense probably benign 0.11
R6312:Vash2 UTSW 1 190,690,880 (GRCm39) missense probably benign 0.29
R7362:Vash2 UTSW 1 190,692,496 (GRCm39) missense probably damaging 1.00
X0021:Vash2 UTSW 1 190,692,641 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCAGTAGCTGGACACGAG -3'
(R):5'- TACGGCCGCGAGAGTTAAAG -3'

Sequencing Primer
(F):5'- TAGCTGGACACGAGGTCTCTTC -3'
(R):5'- GCGAGAGTTAAAGGCCACCC -3'
Posted On 2018-05-21