Incidental Mutation 'R6468:Chd6'
ID516407
Institutional Source Beutler Lab
Gene Symbol Chd6
Ensembl Gene ENSMUSG00000057133
Gene Namechromodomain helicase DNA binding protein 6
Synonyms6330406J24Rik, 5430439G14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.765) question?
Stock #R6468 (G1)
Quality Score128.008
Status Validated
Chromosome2
Chromosomal Location160946978-161109075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 161013067 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 807 (M807T)
Ref Sequence ENSEMBL: ENSMUSP00000042291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039782] [ENSMUST00000134178]
Predicted Effect probably damaging
Transcript: ENSMUST00000039782
AA Change: M807T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: M807T

DomainStartEndE-ValueType
low complexity region 86 106 N/A INTRINSIC
low complexity region 113 143 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
CHROMO 289 355 1.35e-4 SMART
CHROMO 372 430 3.48e-7 SMART
DEXDc 456 658 1.73e-39 SMART
HELICc 812 896 3.84e-23 SMART
low complexity region 1080 1094 N/A INTRINSIC
Blast:DEXDc 1108 1153 4e-23 BLAST
SANT 1445 1504 1.51e0 SMART
low complexity region 1866 1875 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2130 2140 N/A INTRINSIC
low complexity region 2277 2290 N/A INTRINSIC
low complexity region 2333 2349 N/A INTRINSIC
low complexity region 2437 2446 N/A INTRINSIC
low complexity region 2539 2563 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000134178
AA Change: M806T

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123240
Gene: ENSMUSG00000057133
AA Change: M806T

DomainStartEndE-ValueType
low complexity region 86 106 N/A INTRINSIC
low complexity region 113 143 N/A INTRINSIC
low complexity region 213 228 N/A INTRINSIC
CHROMO 288 354 1.35e-4 SMART
CHROMO 371 429 3.48e-7 SMART
DEXDc 455 657 1.73e-39 SMART
HELICc 811 895 3.84e-23 SMART
low complexity region 1079 1093 N/A INTRINSIC
Blast:DEXDc 1107 1152 4e-23 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149866
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G T 10: 82,295,316 T620K probably benign Het
4932438A13Rik T C 3: 37,008,443 I3368T probably damaging Het
Adamtsl5 A G 10: 80,341,913 V305A possibly damaging Het
Adgrl4 A G 3: 151,492,375 T91A probably benign Het
Ano6 A G 15: 95,967,714 I860V probably benign Het
B3galnt1 A G 3: 69,575,533 S132P probably damaging Het
Btbd10 A T 7: 113,347,059 V33E probably benign Het
Cacna1g A T 11: 94,439,722 V989D probably damaging Het
Celsr3 A G 9: 108,835,790 D1807G probably benign Het
Cpxm2 T C 7: 132,070,860 D320G probably damaging Het
Cryzl1 A C 16: 91,692,525 probably null Het
Dcbld2 A T 16: 58,433,373 K158* probably null Het
Depdc5 A G 5: 32,912,231 N437S probably benign Het
Dock7 G A 4: 98,967,227 S1496L probably benign Het
Eea1 T G 10: 96,028,412 I931R probably benign Het
Eif2ak4 C A 2: 118,436,241 L714I probably damaging Het
Enpep A G 3: 129,331,860 probably null Het
Fam83b T A 9: 76,502,131 K238* probably null Het
Fam83f A G 15: 80,692,111 Y321C possibly damaging Het
Fanci A G 7: 79,417,939 I42V probably benign Het
Flg2 A T 3: 93,214,421 R1299S unknown Het
Gak G T 5: 108,623,336 C102* probably null Het
Gcnt7 A G 2: 172,454,073 L277P probably damaging Het
Gucy2d A G 7: 98,449,961 E329G probably benign Het
Hacd1 T C 2: 14,035,944 I167V probably damaging Het
Hdlbp T A 1: 93,417,667 D662V possibly damaging Het
Hspa4 A T 11: 53,265,056 V674E probably benign Het
Hunk A G 16: 90,493,432 Q442R possibly damaging Het
Lce1j A T 3: 92,789,422 C16* probably null Het
Lrat A T 3: 82,903,492 M74K probably damaging Het
Lrig2 G A 3: 104,467,193 R191C probably damaging Het
Lrrc37a A C 11: 103,460,840 F2558L unknown Het
Mctp1 T A 13: 76,731,811 probably null Het
Mecom T A 3: 30,140,386 probably benign Het
Mgst1 A G 6: 138,141,587 probably null Het
Ms4a15 T G 19: 10,993,170 E3A probably benign Het
Myo1d T C 11: 80,557,474 I942V probably benign Het
Neu2 A G 1: 87,596,878 Y195C probably damaging Het
Nipa1 A T 7: 56,019,504 V22E probably benign Het
Olfr1061 T A 2: 86,414,037 N5I probably damaging Het
Olfr733 A T 14: 50,298,467 L281I probably benign Het
Olfr781 T C 10: 129,333,711 S277P possibly damaging Het
Pik3r4 A G 9: 105,685,190 T1223A possibly damaging Het
Ppl T C 16: 5,092,441 D811G probably damaging Het
Prep T A 10: 45,115,107 Y290N probably damaging Het
Ptk6 A T 2: 181,199,102 H215Q probably benign Het
Rad50 A G 11: 53,692,144 I474T possibly damaging Het
Rnf213 T A 11: 119,452,687 V3626E possibly damaging Het
Scn4a C T 11: 106,345,676 V253M probably damaging Het
Snta1 T A 2: 154,377,149 D422V probably damaging Het
Stk38 A G 17: 28,984,112 L160P probably benign Het
Tapbp T C 17: 33,926,098 F323S probably damaging Het
Uggt1 C T 1: 36,173,450 R937Q probably benign Het
Vash2 G A 1: 190,978,287 P57L probably damaging Het
Vmn1r4 G A 6: 56,956,867 V119I probably benign Het
Vmn2r74 T C 7: 85,961,391 D31G probably benign Het
Zfp114 T C 7: 24,177,781 V16A possibly damaging Het
Other mutations in Chd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Chd6 APN 2 161042079 missense probably benign 0.01
IGL00899:Chd6 APN 2 161029298 splice site probably benign
IGL01104:Chd6 APN 2 160961927 missense probably damaging 1.00
IGL01295:Chd6 APN 2 160988370 splice site probably benign
IGL01717:Chd6 APN 2 160965259 missense possibly damaging 0.96
IGL01795:Chd6 APN 2 160961374 missense probably benign 0.00
IGL01814:Chd6 APN 2 161059929 missense probably benign 0.25
IGL02016:Chd6 APN 2 160983678 missense probably damaging 1.00
IGL02104:Chd6 APN 2 160977512 missense probably benign
IGL02158:Chd6 APN 2 161026292 missense possibly damaging 0.73
IGL02313:Chd6 APN 2 160965675 missense probably damaging 1.00
IGL02472:Chd6 APN 2 160984452 splice site probably benign
IGL02522:Chd6 APN 2 160965796 missense probably benign 0.30
IGL02626:Chd6 APN 2 161039350 splice site probably benign
IGL02727:Chd6 APN 2 160969463 missense probably damaging 0.96
IGL02738:Chd6 APN 2 160965698 missense probably benign 0.45
IGL02743:Chd6 APN 2 160960263 missense probably damaging 1.00
IGL02800:Chd6 APN 2 160984632 missense probably damaging 1.00
IGL02811:Chd6 APN 2 160990301 missense probably damaging 1.00
IGL02850:Chd6 APN 2 161019616 nonsense probably null
IGL02979:Chd6 APN 2 160966170 missense possibly damaging 0.48
IGL02993:Chd6 APN 2 161052384 splice site probably benign
IGL03277:Chd6 APN 2 160983061 missense probably null 1.00
IGL03346:Chd6 APN 2 160960362 missense probably benign 0.00
IGL03357:Chd6 APN 2 161018016 splice site probably benign
IGL03134:Chd6 UTSW 2 160965483 missense possibly damaging 0.88
R0106:Chd6 UTSW 2 160967902 missense probably damaging 1.00
R0106:Chd6 UTSW 2 160967902 missense probably damaging 1.00
R0212:Chd6 UTSW 2 161052847 missense probably damaging 0.99
R0363:Chd6 UTSW 2 161014324 missense probably damaging 1.00
R0399:Chd6 UTSW 2 161052688 missense probably damaging 1.00
R0511:Chd6 UTSW 2 160992191 missense probably damaging 0.99
R0771:Chd6 UTSW 2 161019580 missense probably damaging 1.00
R1147:Chd6 UTSW 2 160990271 missense probably damaging 1.00
R1147:Chd6 UTSW 2 160990271 missense probably damaging 1.00
R1184:Chd6 UTSW 2 161030802 missense probably damaging 1.00
R1277:Chd6 UTSW 2 160967815 missense probably damaging 1.00
R1396:Chd6 UTSW 2 160983103 missense probably damaging 1.00
R1647:Chd6 UTSW 2 161042058 missense probably damaging 1.00
R1648:Chd6 UTSW 2 161042058 missense probably damaging 1.00
R1745:Chd6 UTSW 2 160981667 missense probably damaging 0.96
R1766:Chd6 UTSW 2 160966639 missense probably damaging 1.00
R1871:Chd6 UTSW 2 160990256 missense probably damaging 1.00
R1928:Chd6 UTSW 2 160968000 splice site probably benign
R1973:Chd6 UTSW 2 160966387 missense probably damaging 0.99
R2200:Chd6 UTSW 2 160983753 missense probably damaging 1.00
R2340:Chd6 UTSW 2 160965759 frame shift probably null
R2341:Chd6 UTSW 2 160965759 frame shift probably null
R2519:Chd6 UTSW 2 161029876 missense possibly damaging 0.66
R2919:Chd6 UTSW 2 160967880 missense possibly damaging 0.89
R3025:Chd6 UTSW 2 160966552 small deletion probably benign
R3426:Chd6 UTSW 2 160990255 missense probably damaging 1.00
R3427:Chd6 UTSW 2 160990255 missense probably damaging 1.00
R4042:Chd6 UTSW 2 160988333 missense probably damaging 1.00
R4273:Chd6 UTSW 2 160961291 missense probably benign 0.04
R4360:Chd6 UTSW 2 160949856 missense possibly damaging 0.48
R4399:Chd6 UTSW 2 160965318 missense probably benign
R4458:Chd6 UTSW 2 161029876 missense possibly damaging 0.66
R4583:Chd6 UTSW 2 161014194 missense probably damaging 1.00
R4625:Chd6 UTSW 2 160969492 missense probably damaging 1.00
R4740:Chd6 UTSW 2 160970183 missense probably benign
R4765:Chd6 UTSW 2 160966244 nonsense probably null
R4779:Chd6 UTSW 2 160949557 missense probably damaging 1.00
R4877:Chd6 UTSW 2 161029299 splice site probably benign
R5068:Chd6 UTSW 2 160966369 missense possibly damaging 0.54
R5215:Chd6 UTSW 2 160949953 missense probably damaging 1.00
R5275:Chd6 UTSW 2 160969363 missense probably benign
R5405:Chd6 UTSW 2 160965390 missense probably benign
R5598:Chd6 UTSW 2 161014112 missense probably damaging 1.00
R5693:Chd6 UTSW 2 160965265 missense probably benign
R5697:Chd6 UTSW 2 161018051 missense probably damaging 1.00
R5715:Chd6 UTSW 2 160949878 missense probably benign 0.00
R5759:Chd6 UTSW 2 160983762 missense possibly damaging 0.91
R5761:Chd6 UTSW 2 160957078 missense probably damaging 1.00
R5761:Chd6 UTSW 2 160957079 missense probably damaging 1.00
R5954:Chd6 UTSW 2 160965827 missense probably benign 0.00
R6025:Chd6 UTSW 2 160965582 missense probably benign
R6104:Chd6 UTSW 2 161014132 missense probably damaging 1.00
R6247:Chd6 UTSW 2 160950048 missense probably damaging 1.00
R6393:Chd6 UTSW 2 160979487 missense probably damaging 1.00
R6452:Chd6 UTSW 2 160965498 missense possibly damaging 0.76
R6784:Chd6 UTSW 2 160966254 missense probably damaging 1.00
R6803:Chd6 UTSW 2 160960359 missense possibly damaging 0.64
R6869:Chd6 UTSW 2 160965730 missense probably benign
R6895:Chd6 UTSW 2 160988340 missense probably damaging 1.00
R6925:Chd6 UTSW 2 161013127 missense probably damaging 0.98
R7061:Chd6 UTSW 2 161025965 nonsense probably null
R7064:Chd6 UTSW 2 160950063 missense probably damaging 1.00
R7248:Chd6 UTSW 2 160961279 nonsense probably null
R7287:Chd6 UTSW 2 161008392 missense probably benign 0.07
R7431:Chd6 UTSW 2 161026328 missense possibly damaging 0.92
R7486:Chd6 UTSW 2 160950003 missense probably damaging 1.00
R7509:Chd6 UTSW 2 161013154 missense probably damaging 1.00
R7748:Chd6 UTSW 2 160966619 missense probably benign 0.37
R7785:Chd6 UTSW 2 160970175 missense possibly damaging 0.51
Z1088:Chd6 UTSW 2 160966488 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGTCTTACGATTAACAATGGAC -3'
(R):5'- GTCAGGATTCATTGTTTGCCC -3'

Sequencing Primer
(F):5'- CGATTAACAATGGACTTTAGTCAGTC -3'
(R):5'- TGACAAGCTTCTCCCCAA -3'
Posted On2018-05-21