Mutagenetix > Incidental Mutation

Incidental Mutation 'R6468:Chd6'

516407

Institutional Source

Beutler Lab

Gene Symbol

Chd6

Ensembl Gene

ENSMUSG00000057133

Gene Name

chromodomain helicase DNA binding protein 6

Synonyms

6330406J24Rik, 5430439G14Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.715) question?

Stock #

R6468 (G1)

Quality Score

128.008

Status

Validated

Chromosome

Chromosomal Location

160946978-161109075 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 161013067 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 807 (M807T)

Ref Sequence

ENSEMBL: ENSMUSP00000042291 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039782] [ENSMUST00000134178]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000039782
AA Change: M807T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: M807T

Domain	Start	End	E-Value	Type
low complexity region	86	106	N/A	INTRINSIC
low complexity region	113	143	N/A	INTRINSIC
low complexity region	214	229	N/A	INTRINSIC
CHROMO	289	355	1.35e-4	SMART
CHROMO	372	430	3.48e-7	SMART
DEXDc	456	658	1.73e-39	SMART
HELICc	812	896	3.84e-23	SMART
low complexity region	1080	1094	N/A	INTRINSIC
Blast:DEXDc	1108	1153	4e-23	BLAST
SANT	1445	1504	1.51e0	SMART
low complexity region	1866	1875	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2130	2140	N/A	INTRINSIC
low complexity region	2277	2290	N/A	INTRINSIC
low complexity region	2333	2349	N/A	INTRINSIC
low complexity region	2437	2446	N/A	INTRINSIC
low complexity region	2539	2563	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000134178
AA Change: M806T

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000123240
Gene: ENSMUSG00000057133
AA Change: M806T

Domain	Start	End	E-Value	Type
low complexity region	86	106	N/A	INTRINSIC
low complexity region	113	143	N/A	INTRINSIC
low complexity region	213	228	N/A	INTRINSIC
CHROMO	288	354	1.35e-4	SMART
CHROMO	371	429	3.48e-7	SMART
DEXDc	455	657	1.73e-39	SMART
HELICc	811	895	3.84e-23	SMART
low complexity region	1079	1093	N/A	INTRINSIC
Blast:DEXDc	1107	1152	4e-23	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137831

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138078

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149866

Meta Mutation Damage Score

0.4376

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.9%

Validation Efficiency

97% (57/59)

MGI Phenotype

FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	G	T	10: 82,295,316	T620K	probably benign	Het
4932438A13Rik	T	C	3: 37,008,443	I3368T	probably damaging	Het
Adamtsl5	A	G	10: 80,341,913	V305A	possibly damaging	Het
Adgrl4	A	G	3: 151,492,375	T91A	probably benign	Het
Ano6	A	G	15: 95,967,714	I860V	probably benign	Het
B3galnt1	A	G	3: 69,575,533	S132P	probably damaging	Het
Btbd10	A	T	7: 113,347,059	V33E	probably benign	Het
Cacna1g	A	T	11: 94,439,722	V989D	probably damaging	Het
Celsr3	A	G	9: 108,835,790	D1807G	probably benign	Het
Cpxm2	T	C	7: 132,070,860	D320G	probably damaging	Het
Cryzl1	A	C	16: 91,692,525		probably null	Het
Dcbld2	A	T	16: 58,433,373	K158*	probably null	Het
Depdc5	A	G	5: 32,912,231	N437S	probably benign	Het
Dock7	G	A	4: 98,967,227	S1496L	probably benign	Het
Eea1	T	G	10: 96,028,412	I931R	probably benign	Het
Eif2ak4	C	A	2: 118,436,241	L714I	probably damaging	Het
Enpep	A	G	3: 129,331,860		probably null	Het
Fam83b	T	A	9: 76,502,131	K238*	probably null	Het
Fam83f	A	G	15: 80,692,111	Y321C	possibly damaging	Het
Fanci	A	G	7: 79,417,939	I42V	probably benign	Het
Flg2	A	T	3: 93,214,421	R1299S	unknown	Het
Gak	G	T	5: 108,623,336	C102*	probably null	Het
Gcnt7	A	G	2: 172,454,073	L277P	probably damaging	Het
Gucy2d	A	G	7: 98,449,961	E329G	probably benign	Het
Hacd1	T	C	2: 14,035,944	I167V	probably damaging	Het
Hdlbp	T	A	1: 93,417,667	D662V	possibly damaging	Het
Hspa4	A	T	11: 53,265,056	V674E	probably benign	Het
Hunk	A	G	16: 90,493,432	Q442R	possibly damaging	Het
Lce1j	A	T	3: 92,789,422	C16*	probably null	Het
Lrat	A	T	3: 82,903,492	M74K	probably damaging	Het
Lrig2	G	A	3: 104,467,193	R191C	probably damaging	Het
Lrrc37a	A	C	11: 103,460,840	F2558L	unknown	Het
Mctp1	T	A	13: 76,731,811		probably null	Het
Mecom	T	A	3: 30,140,386		probably benign	Het
Mgst1	A	G	6: 138,141,587		probably null	Het
Ms4a15	T	G	19: 10,993,170	E3A	probably benign	Het
Myo1d	T	C	11: 80,557,474	I942V	probably benign	Het
Neu2	A	G	1: 87,596,878	Y195C	probably damaging	Het
Nipa1	A	T	7: 56,019,504	V22E	probably benign	Het
Olfr1061	T	A	2: 86,414,037	N5I	probably damaging	Het
Olfr733	A	T	14: 50,298,467	L281I	probably benign	Het
Olfr781	T	C	10: 129,333,711	S277P	possibly damaging	Het
Pik3r4	A	G	9: 105,685,190	T1223A	possibly damaging	Het
Ppl	T	C	16: 5,092,441	D811G	probably damaging	Het
Prep	T	A	10: 45,115,107	Y290N	probably damaging	Het
Ptk6	A	T	2: 181,199,102	H215Q	probably benign	Het
Rad50	A	G	11: 53,692,144	I474T	possibly damaging	Het
Rnf213	T	A	11: 119,452,687	V3626E	possibly damaging	Het
Scn4a	C	T	11: 106,345,676	V253M	probably damaging	Het
Snta1	T	A	2: 154,377,149	D422V	probably damaging	Het
Stk38	A	G	17: 28,984,112	L160P	probably benign	Het
Tapbp	T	C	17: 33,926,098	F323S	probably damaging	Het
Uggt1	C	T	1: 36,173,450	R937Q	probably benign	Het
Vash2	G	A	1: 190,978,287	P57L	probably damaging	Het
Vmn1r4	G	A	6: 56,956,867	V119I	probably benign	Het
Vmn2r74	T	C	7: 85,961,391	D31G	probably benign	Het
Zfp114	T	C	7: 24,177,781	V16A	possibly damaging	Het

Other mutations in Chd6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00837:Chd6	APN	2	161042079	missense	probably benign	0.01
IGL00899:Chd6	APN	2	161029298	splice site	probably benign
IGL01104:Chd6	APN	2	160961927	missense	probably damaging	1.00
IGL01295:Chd6	APN	2	160988370	splice site	probably benign
IGL01717:Chd6	APN	2	160965259	missense	possibly damaging	0.96
IGL01795:Chd6	APN	2	160961374	missense	probably benign	0.00
IGL01814:Chd6	APN	2	161059929	missense	probably benign	0.25
IGL02016:Chd6	APN	2	160983678	missense	probably damaging	1.00
IGL02104:Chd6	APN	2	160977512	missense	probably benign
IGL02158:Chd6	APN	2	161026292	missense	possibly damaging	0.73
IGL02313:Chd6	APN	2	160965675	missense	probably damaging	1.00
IGL02472:Chd6	APN	2	160984452	splice site	probably benign
IGL02522:Chd6	APN	2	160965796	missense	probably benign	0.30
IGL02626:Chd6	APN	2	161039350	splice site	probably benign
IGL02727:Chd6	APN	2	160969463	missense	probably damaging	0.96
IGL02738:Chd6	APN	2	160965698	missense	probably benign	0.45
IGL02743:Chd6	APN	2	160960263	missense	probably damaging	1.00
IGL02800:Chd6	APN	2	160984632	missense	probably damaging	1.00
IGL02811:Chd6	APN	2	160990301	missense	probably damaging	1.00
IGL02850:Chd6	APN	2	161019616	nonsense	probably null
IGL02979:Chd6	APN	2	160966170	missense	possibly damaging	0.48
IGL02993:Chd6	APN	2	161052384	splice site	probably benign
IGL03277:Chd6	APN	2	160983061	missense	probably null	1.00
IGL03346:Chd6	APN	2	160960362	missense	probably benign	0.00
IGL03357:Chd6	APN	2	161018016	splice site	probably benign
IGL03134:Chd6	UTSW	2	160965483	missense	possibly damaging	0.88
R0106:Chd6	UTSW	2	160967902	missense	probably damaging	1.00
R0106:Chd6	UTSW	2	160967902	missense	probably damaging	1.00
R0212:Chd6	UTSW	2	161052847	missense	probably damaging	0.99
R0363:Chd6	UTSW	2	161014324	missense	probably damaging	1.00
R0399:Chd6	UTSW	2	161052688	missense	probably damaging	1.00
R0511:Chd6	UTSW	2	160992191	missense	probably damaging	0.99
R0771:Chd6	UTSW	2	161019580	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1184:Chd6	UTSW	2	161030802	missense	probably damaging	1.00
R1277:Chd6	UTSW	2	160967815	missense	probably damaging	1.00
R1396:Chd6	UTSW	2	160983103	missense	probably damaging	1.00
R1647:Chd6	UTSW	2	161042058	missense	probably damaging	1.00
R1648:Chd6	UTSW	2	161042058	missense	probably damaging	1.00
R1745:Chd6	UTSW	2	160981667	missense	probably damaging	0.96
R1766:Chd6	UTSW	2	160966639	missense	probably damaging	1.00
R1871:Chd6	UTSW	2	160990256	missense	probably damaging	1.00
R1928:Chd6	UTSW	2	160968000	splice site	probably benign
R1973:Chd6	UTSW	2	160966387	missense	probably damaging	0.99
R2200:Chd6	UTSW	2	160983753	missense	probably damaging	1.00
R2340:Chd6	UTSW	2	160965759	frame shift	probably null
R2341:Chd6	UTSW	2	160965759	frame shift	probably null
R2519:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R2919:Chd6	UTSW	2	160967880	missense	possibly damaging	0.89
R3025:Chd6	UTSW	2	160966552	small deletion	probably benign
R3426:Chd6	UTSW	2	160990255	missense	probably damaging	1.00
R3427:Chd6	UTSW	2	160990255	missense	probably damaging	1.00
R4042:Chd6	UTSW	2	160988333	missense	probably damaging	1.00
R4273:Chd6	UTSW	2	160961291	missense	probably benign	0.04
R4360:Chd6	UTSW	2	160949856	missense	possibly damaging	0.48
R4399:Chd6	UTSW	2	160965318	missense	probably benign
R4458:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R4583:Chd6	UTSW	2	161014194	missense	probably damaging	1.00
R4625:Chd6	UTSW	2	160969492	missense	probably damaging	1.00
R4740:Chd6	UTSW	2	160970183	missense	probably benign
R4765:Chd6	UTSW	2	160966244	nonsense	probably null
R4779:Chd6	UTSW	2	160949557	missense	probably damaging	1.00
R4877:Chd6	UTSW	2	161029299	splice site	probably benign
R5068:Chd6	UTSW	2	160966369	missense	possibly damaging	0.54
R5215:Chd6	UTSW	2	160949953	missense	probably damaging	1.00
R5275:Chd6	UTSW	2	160969363	missense	probably benign
R5405:Chd6	UTSW	2	160965390	missense	probably benign
R5598:Chd6	UTSW	2	161014112	missense	probably damaging	1.00
R5693:Chd6	UTSW	2	160965265	missense	probably benign
R5697:Chd6	UTSW	2	161018051	missense	probably damaging	1.00
R5715:Chd6	UTSW	2	160949878	missense	probably benign	0.00
R5759:Chd6	UTSW	2	160983762	missense	possibly damaging	0.91
R5761:Chd6	UTSW	2	160957078	missense	probably damaging	1.00
R5761:Chd6	UTSW	2	160957079	missense	probably damaging	1.00
R5954:Chd6	UTSW	2	160965827	missense	probably benign	0.00
R6025:Chd6	UTSW	2	160965582	missense	probably benign
R6104:Chd6	UTSW	2	161014132	missense	probably damaging	1.00
R6247:Chd6	UTSW	2	160950048	missense	probably damaging	1.00
R6393:Chd6	UTSW	2	160979487	missense	probably damaging	1.00
R6452:Chd6	UTSW	2	160965498	missense	possibly damaging	0.76
R6784:Chd6	UTSW	2	160966254	missense	probably damaging	1.00
R6803:Chd6	UTSW	2	160960359	missense	possibly damaging	0.64
R6869:Chd6	UTSW	2	160965730	missense	probably benign
R6895:Chd6	UTSW	2	160988340	missense	probably damaging	1.00
R6925:Chd6	UTSW	2	161013127	missense	probably damaging	0.98
R7061:Chd6	UTSW	2	161025965	nonsense	probably null
R7064:Chd6	UTSW	2	160950063	missense	probably damaging	1.00
R7248:Chd6	UTSW	2	160961279	nonsense	probably null
R7287:Chd6	UTSW	2	161008392	missense	probably benign	0.07
R7431:Chd6	UTSW	2	161026328	missense	possibly damaging	0.92
R7486:Chd6	UTSW	2	160950003	missense	probably damaging	1.00
R7509:Chd6	UTSW	2	161013154	missense	probably damaging	1.00
R7699:Chd6	UTSW	2	161025943	missense	probably benign	0.13
R7748:Chd6	UTSW	2	160966619	missense	probably benign	0.37
R7785:Chd6	UTSW	2	160970175	missense	possibly damaging	0.51
R8002:Chd6	UTSW	2	160990321	missense	probably damaging	1.00
R8261:Chd6	UTSW	2	160957082	missense	probably damaging	1.00
R8317:Chd6	UTSW	2	160990321	missense	probably damaging	1.00
R8388:Chd6	UTSW	2	161019651	missense	probably damaging	1.00
R8865:Chd6	UTSW	2	161021069	missense	probably benign	0.10
R8867:Chd6	UTSW	2	161021069	missense	probably benign	0.10
R8996:Chd6	UTSW	2	160981623	missense	probably damaging	1.00
R9091:Chd6	UTSW	2	161029873	nonsense	probably null
R9270:Chd6	UTSW	2	161029873	nonsense	probably null
R9310:Chd6	UTSW	2	161039261	missense	probably damaging	1.00
R9367:Chd6	UTSW	2	161029864	missense	possibly damaging	0.83
R9438:Chd6	UTSW	2	160957158	missense	probably benign	0.01
R9756:Chd6	UTSW	2	160960339	missense	probably benign
Z1088:Chd6	UTSW	2	160966488	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGGTCTTACGATTAACAATGGAC -3'
(R):5'- GTCAGGATTCATTGTTTGCCC -3'

Sequencing Primer
(F):5'- CGATTAACAATGGACTTTAGTCAGTC -3'
(R):5'- TGACAAGCTTCTCCCCAA -3'

Posted On

2018-05-21