Incidental Mutation 'R6468:Depdc5'
ID516420
Institutional Source Beutler Lab
Gene Symbol Depdc5
Ensembl Gene ENSMUSG00000037426
Gene NameDEP domain containing 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6468 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location32863701-32994236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32912231 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 437 (N437S)
Ref Sequence ENSEMBL: ENSMUSP00000085207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049780] [ENSMUST00000087897] [ENSMUST00000119705] [ENSMUST00000120902] [ENSMUST00000195980]
Predicted Effect probably benign
Transcript: ENSMUST00000049780
AA Change: N437S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052807
Gene: ENSMUSG00000037426
AA Change: N437S

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-64 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087897
AA Change: N437S

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000085207
Gene: ENSMUSG00000037426
AA Change: N437S

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 2.3e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 994 1006 N/A INTRINSIC
low complexity region 1159 1175 N/A INTRINSIC
DEP 1184 1259 2.49e-15 SMART
low complexity region 1322 1335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119705
AA Change: N437S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113862
Gene: ENSMUSG00000037426
AA Change: N437S

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3e-117 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1150 1166 N/A INTRINSIC
DEP 1175 1250 2.49e-15 SMART
low complexity region 1313 1326 N/A INTRINSIC
low complexity region 1511 1525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120902
AA Change: N437S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426
AA Change: N437S

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1128 1144 N/A INTRINSIC
DEP 1153 1228 2.49e-15 SMART
low complexity region 1291 1304 N/A INTRINSIC
low complexity region 1489 1503 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158455
Predicted Effect probably benign
Transcript: ENSMUST00000195980
SMART Domains Protein: ENSMUSP00000143228
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 147 4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201802
Predicted Effect probably benign
Transcript: ENSMUST00000201836
Meta Mutation Damage Score 0.0587 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in neurons exhibit reduced body weight, limb grasping, premature death, spontaneous seizure, increased brain size due to neuron hypertrophy and increased PTZ seizure susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G T 10: 82,295,316 T620K probably benign Het
4932438A13Rik T C 3: 37,008,443 I3368T probably damaging Het
Adamtsl5 A G 10: 80,341,913 V305A possibly damaging Het
Adgrl4 A G 3: 151,492,375 T91A probably benign Het
Ano6 A G 15: 95,967,714 I860V probably benign Het
B3galnt1 A G 3: 69,575,533 S132P probably damaging Het
Btbd10 A T 7: 113,347,059 V33E probably benign Het
Cacna1g A T 11: 94,439,722 V989D probably damaging Het
Celsr3 A G 9: 108,835,790 D1807G probably benign Het
Chd6 A G 2: 161,013,067 M807T probably damaging Het
Cpxm2 T C 7: 132,070,860 D320G probably damaging Het
Cryzl1 A C 16: 91,692,525 probably null Het
Dcbld2 A T 16: 58,433,373 K158* probably null Het
Dock7 G A 4: 98,967,227 S1496L probably benign Het
Eea1 T G 10: 96,028,412 I931R probably benign Het
Eif2ak4 C A 2: 118,436,241 L714I probably damaging Het
Enpep A G 3: 129,331,860 probably null Het
Fam83b T A 9: 76,502,131 K238* probably null Het
Fam83f A G 15: 80,692,111 Y321C possibly damaging Het
Fanci A G 7: 79,417,939 I42V probably benign Het
Flg2 A T 3: 93,214,421 R1299S unknown Het
Gak G T 5: 108,623,336 C102* probably null Het
Gcnt7 A G 2: 172,454,073 L277P probably damaging Het
Gucy2d A G 7: 98,449,961 E329G probably benign Het
Hacd1 T C 2: 14,035,944 I167V probably damaging Het
Hdlbp T A 1: 93,417,667 D662V possibly damaging Het
Hspa4 A T 11: 53,265,056 V674E probably benign Het
Hunk A G 16: 90,493,432 Q442R possibly damaging Het
Lce1j A T 3: 92,789,422 C16* probably null Het
Lrat A T 3: 82,903,492 M74K probably damaging Het
Lrig2 G A 3: 104,467,193 R191C probably damaging Het
Lrrc37a A C 11: 103,460,840 F2558L unknown Het
Mctp1 T A 13: 76,731,811 probably null Het
Mecom T A 3: 30,140,386 probably benign Het
Mgst1 A G 6: 138,141,587 probably null Het
Ms4a15 T G 19: 10,993,170 E3A probably benign Het
Myo1d T C 11: 80,557,474 I942V probably benign Het
Neu2 A G 1: 87,596,878 Y195C probably damaging Het
Nipa1 A T 7: 56,019,504 V22E probably benign Het
Olfr1061 T A 2: 86,414,037 N5I probably damaging Het
Olfr733 A T 14: 50,298,467 L281I probably benign Het
Olfr781 T C 10: 129,333,711 S277P possibly damaging Het
Pik3r4 A G 9: 105,685,190 T1223A possibly damaging Het
Ppl T C 16: 5,092,441 D811G probably damaging Het
Prep T A 10: 45,115,107 Y290N probably damaging Het
Ptk6 A T 2: 181,199,102 H215Q probably benign Het
Rad50 A G 11: 53,692,144 I474T possibly damaging Het
Rnf213 T A 11: 119,452,687 V3626E possibly damaging Het
Scn4a C T 11: 106,345,676 V253M probably damaging Het
Snta1 T A 2: 154,377,149 D422V probably damaging Het
Stk38 A G 17: 28,984,112 L160P probably benign Het
Tapbp T C 17: 33,926,098 F323S probably damaging Het
Uggt1 C T 1: 36,173,450 R937Q probably benign Het
Vash2 G A 1: 190,978,287 P57L probably damaging Het
Vmn1r4 G A 6: 56,956,867 V119I probably benign Het
Vmn2r74 T C 7: 85,961,391 D31G probably benign Het
Zfp114 T C 7: 24,177,781 V16A possibly damaging Het
Other mutations in Depdc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Depdc5 APN 5 32967814 splice site probably null
IGL01019:Depdc5 APN 5 32893401 missense probably damaging 0.96
IGL01067:Depdc5 APN 5 32899067 splice site probably null
IGL01405:Depdc5 APN 5 32937689 missense possibly damaging 0.90
IGL01577:Depdc5 APN 5 32955897 missense possibly damaging 0.49
IGL01633:Depdc5 APN 5 32924200 missense probably damaging 1.00
IGL01998:Depdc5 APN 5 32945151 splice site probably benign
IGL02025:Depdc5 APN 5 32946632 critical splice acceptor site probably null
IGL02167:Depdc5 APN 5 32903801 missense probably damaging 1.00
IGL02537:Depdc5 APN 5 32967787 missense probably damaging 1.00
IGL02812:Depdc5 APN 5 32893368 splice site probably benign
IGL03001:Depdc5 APN 5 32945090 missense possibly damaging 0.74
IGL03253:Depdc5 APN 5 32868813 unclassified probably benign
IGL02988:Depdc5 UTSW 5 32956167 utr 3 prime probably null
R0038:Depdc5 UTSW 5 32868853 missense probably benign 0.01
R0038:Depdc5 UTSW 5 32868853 missense probably benign 0.01
R0153:Depdc5 UTSW 5 32933937 splice site probably benign
R0179:Depdc5 UTSW 5 32901574 unclassified probably benign
R0212:Depdc5 UTSW 5 32912242 missense probably benign 0.00
R0239:Depdc5 UTSW 5 32943240 missense probably damaging 1.00
R0239:Depdc5 UTSW 5 32943240 missense probably damaging 1.00
R0302:Depdc5 UTSW 5 32904546 critical splice donor site probably benign
R0511:Depdc5 UTSW 5 32945028 nonsense probably null
R0677:Depdc5 UTSW 5 32901470 missense probably damaging 1.00
R0884:Depdc5 UTSW 5 32917978 missense possibly damaging 0.94
R0973:Depdc5 UTSW 5 32986966 missense possibly damaging 0.92
R1314:Depdc5 UTSW 5 32877074 missense probably damaging 1.00
R1611:Depdc5 UTSW 5 32990953 missense probably damaging 1.00
R1687:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R1748:Depdc5 UTSW 5 32917942 missense probably benign 0.24
R1903:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R1956:Depdc5 UTSW 5 32903831 missense probably damaging 1.00
R1997:Depdc5 UTSW 5 32901906 critical splice donor site probably null
R2079:Depdc5 UTSW 5 32946674 missense possibly damaging 0.75
R2131:Depdc5 UTSW 5 32990781 nonsense probably null
R2291:Depdc5 UTSW 5 32979402 missense probably damaging 1.00
R2422:Depdc5 UTSW 5 32991035 missense probably damaging 1.00
R2851:Depdc5 UTSW 5 32924171 missense probably damaging 0.96
R2852:Depdc5 UTSW 5 32924171 missense probably damaging 0.96
R2937:Depdc5 UTSW 5 32901621 intron probably null
R2938:Depdc5 UTSW 5 32901621 intron probably null
R2974:Depdc5 UTSW 5 32934017 critical splice donor site probably null
R3884:Depdc5 UTSW 5 32944077 missense probably damaging 1.00
R3967:Depdc5 UTSW 5 32944115 nonsense probably null
R4118:Depdc5 UTSW 5 32964635 missense probably damaging 1.00
R4197:Depdc5 UTSW 5 32991203 missense possibly damaging 0.93
R4407:Depdc5 UTSW 5 32904534 critical splice donor site probably null
R4534:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R4535:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R4538:Depdc5 UTSW 5 32983946 missense probably damaging 1.00
R4613:Depdc5 UTSW 5 32975446 missense probably damaging 1.00
R4736:Depdc5 UTSW 5 32975322 missense probably benign
R4738:Depdc5 UTSW 5 32975322 missense probably benign
R4765:Depdc5 UTSW 5 32937635 missense probably damaging 1.00
R5021:Depdc5 UTSW 5 32979414 missense probably damaging 1.00
R5259:Depdc5 UTSW 5 32938291 missense probably damaging 1.00
R5261:Depdc5 UTSW 5 32938291 missense probably damaging 1.00
R5541:Depdc5 UTSW 5 32864629 utr 5 prime probably benign
R5594:Depdc5 UTSW 5 32901490 missense possibly damaging 0.46
R5929:Depdc5 UTSW 5 32975506 nonsense probably null
R6132:Depdc5 UTSW 5 32910467 missense probably damaging 0.99
R6146:Depdc5 UTSW 5 32968731 missense probably benign 0.01
R6336:Depdc5 UTSW 5 32964507 unclassified probably null
R6911:Depdc5 UTSW 5 32924192 missense probably damaging 1.00
R6969:Depdc5 UTSW 5 32983860 missense probably damaging 1.00
R7002:Depdc5 UTSW 5 32877158 splice site probably null
R7066:Depdc5 UTSW 5 32901848 missense probably benign 0.08
R7231:Depdc5 UTSW 5 32901865 missense possibly damaging 0.92
R7264:Depdc5 UTSW 5 32967745 missense probably benign
R7302:Depdc5 UTSW 5 32979508 missense probably damaging 1.00
R7386:Depdc5 UTSW 5 32927936 missense probably benign
R7564:Depdc5 UTSW 5 32901510 missense probably damaging 1.00
R7636:Depdc5 UTSW 5 32917983 missense probably benign
R7795:Depdc5 UTSW 5 32944103 missense probably damaging 1.00
R7845:Depdc5 UTSW 5 32903915 splice site probably null
R8013:Depdc5 UTSW 5 32973842 missense probably benign 0.01
R8037:Depdc5 UTSW 5 32959348 critical splice donor site probably null
R8038:Depdc5 UTSW 5 32959348 critical splice donor site probably null
R8065:Depdc5 UTSW 5 32895908 missense possibly damaging 0.89
R8067:Depdc5 UTSW 5 32895908 missense possibly damaging 0.89
R8108:Depdc5 UTSW 5 32945049 missense probably benign 0.01
R8112:Depdc5 UTSW 5 32968706 missense possibly damaging 0.67
R8213:Depdc5 UTSW 5 32937637 missense probably damaging 1.00
X0027:Depdc5 UTSW 5 32904292 missense probably damaging 1.00
Z1176:Depdc5 UTSW 5 32943282 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TCCCATCTGGATAAGGTTGTG -3'
(R):5'- CACTGCCGCTTACAAGGTAC -3'

Sequencing Primer
(F):5'- GGTGAGAATTAAAAGGCTTGACACTG -3'
(R):5'- CTGCCGCTTACAAGGTACAAAGG -3'
Posted On2018-05-21